Mutagenetix > Incidental Mutation

Incidental Mutation 'R8206:Nrp1'

635919

Institutional Source

Beutler Lab

Gene Symbol

Nrp1

Ensembl Gene

ENSMUSG00000025810

Gene Name

neuropilin 1

Synonyms

Neuropilin-1, NP-1, NPN-1, Npn1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8206 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128358604-128503363 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128457957 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 361 (D361G)

Ref Sequence

ENSEMBL: ENSMUSP00000026917 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026917]

AlphaFold

P97333

PDB Structure

Mouse Neuropilin-1, extracellular domains 1-4 (a1a2b1b2) [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000026917
AA Change: D361G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000026917
Gene: ENSMUSG00000025810
AA Change: D361G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CUB	27	141	1.44e-43	SMART
CUB	147	265	9.19e-42	SMART
FA58C	274	424	5.21e-44	SMART
FA58C	430	583	4.15e-20	SMART
low complexity region	587	599	N/A	INTRINSIC
MAM	645	811	4.94e-69	SMART
Pfam:DUF3481	837	920	3.5e-31	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two neuropilins, which contain specific protein domains which allow them to participate in several different types of signaling pathways that control cell migration. Neuropilins contain a large N-terminal extracellular domain, made up of complement-binding, coagulation factor V/VIII, and meprin domains. These proteins also contains a short membrane-spanning domain and a small cytoplasmic domain. Neuropilins bind many ligands and various types of co-receptors; they affect cell survival, migration, and attraction. Some of the ligands and co-receptors bound by neuropilins are vascular endothelial growth factor (VEGF) and semaphorin family members. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice show embryonic death, impaired neuronal migration and axon guidance, and vascular defects including a disorganized yolk sac vascular plexus, and malformed brachial arch arteries and great vessels. Mice lacking the cytoplasmic domain show altered retinal arteriovenous patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	A	T	9: 35,839,423	F34L	possibly damaging	Het
Ano4	A	G	10: 89,025,096	Y342H	probably damaging	Het
Aqp4	T	A	18: 15,393,659	D255V	possibly damaging	Het
Arhgap26	C	A	18: 39,306,750	S247*	probably null	Het
Arid4a	A	G	12: 71,086,587	D1154G	probably damaging	Het
Atpaf2	A	G	11: 60,404,478	I182T	probably damaging	Het
Cacna1i	C	A	15: 80,389,815		probably null	Het
Ccdc38	A	G	10: 93,563,284	S205G	probably damaging	Het
Cep63	A	G	9: 102,621,271		probably benign	Het
Cyp24a1	T	C	2: 170,491,669	T255A	possibly damaging	Het
Dlg5	A	G	14: 24,160,268	S787P	possibly damaging	Het
Dnah6	A	T	6: 73,037,566	C3679*	probably null	Het
Dpy19l3	T	C	7: 35,729,730	Y95C	probably damaging	Het
Erc2	G	A	14: 28,303,015		probably null	Het
Ezh2	A	T	6: 47,532,900		probably null	Het
Fgfr1	A	G	8: 25,570,242	T463A	probably damaging	Het
Flvcr2	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Fsip2	T	C	2: 82,990,464	S5514P	possibly damaging	Het
Glrb	A	G	3: 80,851,066	Y347H	probably damaging	Het
Gm14325	C	A	2: 177,832,974	C105F	probably damaging	Het
Hgsnat	T	C	8: 25,954,637	T428A	probably damaging	Het
Ighv1-76	T	C	12: 115,848,314	M1V	probably null	Het
Inppl1	A	G	7: 101,823,576	I1207T	possibly damaging	Het
Kmt2c	T	A	5: 25,314,539	Q2191L	probably damaging	Het
Krt79	T	A	15: 101,940,270		probably null	Het
Mast4	G	A	13: 102,735,739	L2374F	probably damaging	Het
Mgam	A	G	6: 40,680,235	N951S	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naip6	A	T	13: 100,294,836	C1164*	probably null	Het
Nfatc2ip	G	T	7: 126,390,734	D189E	probably damaging	Het
Nrp2	T	C	1: 62,747,215	I293T	probably damaging	Het
Pde3a	T	C	6: 141,487,885	V831A	probably damaging	Het
Pirb	A	G	7: 3,712,906		probably null	Het
Plch1	G	T	3: 63,702,626		probably null	Het
Plekhh2	A	G	17: 84,590,849	T973A	possibly damaging	Het
Ppp1r35	T	A	5: 137,780,034	I97K	unknown	Het
Ppp1r3c	C	T	19: 36,733,446	G308E	probably benign	Het
Prss12	G	A	3: 123,464,962		probably null	Het
Rad51b	A	G	12: 79,314,941	D142G	probably damaging	Het
Slc13a3	C	T	2: 165,406,825	G553D	probably damaging	Het
Spata31d1d	A	C	13: 59,731,530	V64G	probably benign	Het
Srp68	G	A	11: 116,273,983	R42C	probably damaging	Het
Syne2	T	C	12: 76,015,591	V4229A	probably benign	Het
Tas2r144	G	A	6: 42,215,391	V22M	probably damaging	Het
Tcf7l1	A	G	6: 72,627,412	L583P	probably damaging	Het
Tdgf1	G	A	9: 110,944,284		probably benign	Het
Tdrd3	A	G	14: 87,511,778	D708G	probably benign	Het
Tns4	A	T	11: 99,085,801	L98Q	probably damaging	Het
Zfp677	T	A	17: 21,392,455		probably null	Het

Other mutations in Nrp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00911:Nrp1	APN	8	128476207	missense	probably benign
IGL01412:Nrp1	APN	8	128418707	splice site	probably benign
IGL01586:Nrp1	APN	8	128432032	missense	possibly damaging	0.86
IGL02307:Nrp1	APN	8	128502720	missense	probably damaging	1.00
IGL02500:Nrp1	APN	8	128425799	missense	possibly damaging	0.94
IGL02547:Nrp1	APN	8	128493031	missense	probably benign
R0046:Nrp1	UTSW	8	128500608	splice site	probably benign
R0281:Nrp1	UTSW	8	128460683	missense	probably damaging	0.96
R0403:Nrp1	UTSW	8	128457969	missense	probably damaging	1.00
R0610:Nrp1	UTSW	8	128502618	missense	probably damaging	1.00
R1055:Nrp1	UTSW	8	128468598	missense	possibly damaging	0.68
R1229:Nrp1	UTSW	8	128418716	nonsense	probably null
R1263:Nrp1	UTSW	8	128468389	missense	probably damaging	1.00
R1340:Nrp1	UTSW	8	128434355	missense	probably damaging	1.00
R1397:Nrp1	UTSW	8	128418716	nonsense	probably null
R1462:Nrp1	UTSW	8	128502798	missense	probably benign
R1462:Nrp1	UTSW	8	128502798	missense	probably benign
R1531:Nrp1	UTSW	8	128425969	missense	probably null	0.19
R1587:Nrp1	UTSW	8	128476282	missense	probably damaging	1.00
R1719:Nrp1	UTSW	8	128425885	missense	probably damaging	1.00
R1733:Nrp1	UTSW	8	128468493	missense	probably benign	0.02
R1785:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R1786:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2047:Nrp1	UTSW	8	128498096	splice site	probably benign
R2130:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2132:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2133:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2163:Nrp1	UTSW	8	128497871	missense	probably damaging	1.00
R2338:Nrp1	UTSW	8	128497904	missense	probably benign	0.01
R2407:Nrp1	UTSW	8	128431945	missense	probably damaging	0.99
R3405:Nrp1	UTSW	8	128498088	nonsense	probably null
R3748:Nrp1	UTSW	8	128457980	missense	probably damaging	1.00
R4347:Nrp1	UTSW	8	128480991	critical splice donor site	probably null
R4379:Nrp1	UTSW	8	128468467	missense	probably damaging	1.00
R4646:Nrp1	UTSW	8	128457944	missense	probably benign	0.00
R4688:Nrp1	UTSW	8	128502566	missense	probably benign	0.01
R4916:Nrp1	UTSW	8	128502804	nonsense	probably null
R5077:Nrp1	UTSW	8	128500673	critical splice donor site	probably null
R5301:Nrp1	UTSW	8	128434197	splice site	probably null
R5509:Nrp1	UTSW	8	128425915	missense	possibly damaging	0.73
R5745:Nrp1	UTSW	8	128468448	missense	probably benign	0.22
R5873:Nrp1	UTSW	8	128468377	missense	probably damaging	1.00
R5987:Nrp1	UTSW	8	128476169	missense	probably damaging	1.00
R6060:Nrp1	UTSW	8	128497938	missense	probably damaging	1.00
R6757:Nrp1	UTSW	8	128425868	missense	probably damaging	1.00
R6889:Nrp1	UTSW	8	128493057	missense	probably damaging	1.00
R7025:Nrp1	UTSW	8	128480954	missense	probably damaging	1.00
R7065:Nrp1	UTSW	8	128460712	missense	probably benign
R7290:Nrp1	UTSW	8	128476296	critical splice donor site	probably null
R7369:Nrp1	UTSW	8	128431915	missense	probably damaging	1.00
R7553:Nrp1	UTSW	8	128431987	missense	probably damaging	1.00
R7650:Nrp1	UTSW	8	128498014	missense	possibly damaging	0.87
R8043:Nrp1	UTSW	8	128432023	missense	probably benign	0.00
R8088:Nrp1	UTSW	8	128468516	nonsense	probably null
R8193:Nrp1	UTSW	8	128460706	missense	probably damaging	1.00
R8245:Nrp1	UTSW	8	128487953	missense	probably benign
R8684:Nrp1	UTSW	8	128359404	start gained	probably benign
R8734:Nrp1	UTSW	8	128480939	missense	probably benign	0.23
R8875:Nrp1	UTSW	8	128480991	critical splice donor site	probably null
R9054:Nrp1	UTSW	8	128487908	missense	probably benign
R9253:Nrp1	UTSW	8	128502663	missense	possibly damaging	0.47
R9301:Nrp1	UTSW	8	128363378	missense	probably damaging	1.00
R9437:Nrp1	UTSW	8	128460627	missense	probably benign	0.01
R9606:Nrp1	UTSW	8	128502548	missense	probably benign	0.00
R9607:Nrp1	UTSW	8	128425781	missense	probably benign	0.01
R9691:Nrp1	UTSW	8	128476169	missense	probably damaging	1.00
X0066:Nrp1	UTSW	8	128460645	missense	possibly damaging	0.95
Z1186:Nrp1	UTSW	8	128497938	missense	probably damaging	1.00
Z1189:Nrp1	UTSW	8	128497938	missense	probably damaging	1.00
Z1192:Nrp1	UTSW	8	128497938	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGGAAAAGCTGTTTAGGTC -3'
(R):5'- CGGATCTGGGAACATGAGACTC -3'

Sequencing Primer
(F):5'- AGGTCACAGCTGTGCTTG -3'
(R):5'- CTGGGAACATGAGACTCTTTAAACC -3'

Posted On

2020-07-13