Incidental Mutation 'R8206:Pate5'
ID 635920
Institutional Source Beutler Lab
Gene Symbol Pate5
Ensembl Gene ENSMUSG00000047980
Gene Name prostate and testis expressed 5
Synonyms Pate-A, 9230110F15Rik, mANLP3, D730048I06Rik, Pate-C, Anlp2
MMRRC Submission 067629-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R8206 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 35749625-35755446 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 35750719 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 34 (F34L)
Ref Sequence ENSEMBL: ENSMUSP00000051917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054175]
AlphaFold Q9D262
Predicted Effect possibly damaging
Transcript: ENSMUST00000054175
AA Change: F34L

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051917
Gene: ENSMUSG00000047980
AA Change: F34L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 A G 10: 88,860,958 (GRCm39) Y342H probably damaging Het
Aqp4 T A 18: 15,526,716 (GRCm39) D255V possibly damaging Het
Arhgap26 C A 18: 39,439,803 (GRCm39) S247* probably null Het
Arid4a A G 12: 71,133,361 (GRCm39) D1154G probably damaging Het
Atpaf2 A G 11: 60,295,304 (GRCm39) I182T probably damaging Het
Cacna1i C A 15: 80,274,016 (GRCm39) probably null Het
Ccdc38 A G 10: 93,399,146 (GRCm39) S205G probably damaging Het
Cep63 A G 9: 102,498,470 (GRCm39) probably benign Het
Cripto G A 9: 110,773,352 (GRCm39) probably benign Het
Cyp24a1 T C 2: 170,333,589 (GRCm39) T255A possibly damaging Het
Dlg5 A G 14: 24,210,336 (GRCm39) S787P possibly damaging Het
Dnah6 A T 6: 73,014,549 (GRCm39) C3679* probably null Het
Dpy19l3 T C 7: 35,429,155 (GRCm39) Y95C probably damaging Het
Erc2 G A 14: 28,024,972 (GRCm39) probably null Het
Ezh2 A T 6: 47,509,834 (GRCm39) probably null Het
Fgfr1 A G 8: 26,060,258 (GRCm39) T463A probably damaging Het
Flvcr2 GTAGTGTATA GTA 12: 85,849,922 (GRCm39) probably null Het
Fsip2 T C 2: 82,820,808 (GRCm39) S5514P possibly damaging Het
Glrb A G 3: 80,758,373 (GRCm39) Y347H probably damaging Het
Gm14325 C A 2: 177,474,767 (GRCm39) C105F probably damaging Het
Hgsnat T C 8: 26,444,665 (GRCm39) T428A probably damaging Het
Ighv1-76 T C 12: 115,811,934 (GRCm39) M1V probably null Het
Inppl1 A G 7: 101,472,783 (GRCm39) I1207T possibly damaging Het
Kmt2c T A 5: 25,519,537 (GRCm39) Q2191L probably damaging Het
Krt79 T A 15: 101,848,705 (GRCm39) probably null Het
Mast4 G A 13: 102,872,247 (GRCm39) L2374F probably damaging Het
Mgam A G 6: 40,657,169 (GRCm39) N951S probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Naip6 A T 13: 100,431,344 (GRCm39) C1164* probably null Het
Nfatc2ip G T 7: 125,989,906 (GRCm39) D189E probably damaging Het
Nrp1 A G 8: 129,184,438 (GRCm39) D361G probably damaging Het
Nrp2 T C 1: 62,786,374 (GRCm39) I293T probably damaging Het
Pde3a T C 6: 141,433,611 (GRCm39) V831A probably damaging Het
Pirb A G 7: 3,715,905 (GRCm39) probably null Het
Plch1 G T 3: 63,610,047 (GRCm39) probably null Het
Plekhh2 A G 17: 84,898,277 (GRCm39) T973A possibly damaging Het
Ppp1r35 T A 5: 137,778,296 (GRCm39) I97K unknown Het
Ppp1r3c C T 19: 36,710,846 (GRCm39) G308E probably benign Het
Prss12 G A 3: 123,258,611 (GRCm39) probably null Het
Rad51b A G 12: 79,361,715 (GRCm39) D142G probably damaging Het
Slc13a3 C T 2: 165,248,745 (GRCm39) G553D probably damaging Het
Spata31d1d A C 13: 59,879,344 (GRCm39) V64G probably benign Het
Srp68 G A 11: 116,164,809 (GRCm39) R42C probably damaging Het
Syne2 T C 12: 76,062,365 (GRCm39) V4229A probably benign Het
Tas2r144 G A 6: 42,192,325 (GRCm39) V22M probably damaging Het
Tcf7l1 A G 6: 72,604,395 (GRCm39) L583P probably damaging Het
Tdrd3 A G 14: 87,749,214 (GRCm39) D708G probably benign Het
Tns4 A T 11: 98,976,627 (GRCm39) L98Q probably damaging Het
Zfp677 T A 17: 21,612,717 (GRCm39) probably null Het
Other mutations in Pate5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02732:Pate5 APN 9 35,750,345 (GRCm39) missense probably damaging 1.00
R0904:Pate5 UTSW 9 35,750,366 (GRCm39) missense probably damaging 1.00
R1599:Pate5 UTSW 9 35,750,333 (GRCm39) missense probably benign 0.05
R2135:Pate5 UTSW 9 35,750,479 (GRCm39) splice site probably null
R4135:Pate5 UTSW 9 35,750,724 (GRCm39) missense possibly damaging 0.94
R4951:Pate5 UTSW 9 35,750,732 (GRCm39) missense probably damaging 0.99
R6455:Pate5 UTSW 9 35,755,351 (GRCm39) nonsense probably null
R6567:Pate5 UTSW 9 35,750,411 (GRCm39) missense probably benign 0.14
R8889:Pate5 UTSW 9 35,750,682 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACCAACCCTGTTTCCCGAG -3'
(R):5'- CAATCAAAATTGTGATGTCAAGCCC -3'

Sequencing Primer
(F):5'- CCCGAGGAGGAATATAGCTTCTTC -3'
(R):5'- ATTGTGATGTCAAGCCCTTAGC -3'
Posted On 2020-07-13