Incidental Mutation 'R8206:Cripto'
ID 635921
Institutional Source Beutler Lab
Gene Symbol Cripto
Ensembl Gene ENSMUSG00000032494
Gene Name cripto, EGF-CFC family member
Synonyms CR1, Tdgf1
MMRRC Submission 067629-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.268) question?
Stock # R8206 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 110768676-110775226 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) G to A at 110773352 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035075] [ENSMUST00000197460] [ENSMUST00000199196] [ENSMUST00000199782]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000035075
SMART Domains Protein: ENSMUSP00000035075
Gene: ENSMUSG00000032494

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 65 91 1.8e1 SMART
Pfam:CFC 99 133 2.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197460
SMART Domains Protein: ENSMUSP00000143394
Gene: ENSMUSG00000032494

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199196
SMART Domains Protein: ENSMUSP00000142397
Gene: ENSMUSG00000032494

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199782
SMART Domains Protein: ENSMUSP00000143669
Gene: ENSMUSG00000032494

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 31 57 8.9e-2 SMART
Pfam:CFC 65 90 1.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an epidermal growth factor-related protein that contains a cripto, FRL-1, and cryptic domain. The encoded protein is an extracellular, membrane-bound signaling protein that plays an essential role in embryonic development and tumor growth. Mutations in this gene are associated with forebrain defects. Pseudogenes of this gene are found on chromosomes 2, 3, 6, 8, 19 and X. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in rostral-caudal axis formation, embryonic development and heart development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 A G 10: 88,860,958 (GRCm39) Y342H probably damaging Het
Aqp4 T A 18: 15,526,716 (GRCm39) D255V possibly damaging Het
Arhgap26 C A 18: 39,439,803 (GRCm39) S247* probably null Het
Arid4a A G 12: 71,133,361 (GRCm39) D1154G probably damaging Het
Atpaf2 A G 11: 60,295,304 (GRCm39) I182T probably damaging Het
Cacna1i C A 15: 80,274,016 (GRCm39) probably null Het
Ccdc38 A G 10: 93,399,146 (GRCm39) S205G probably damaging Het
Cep63 A G 9: 102,498,470 (GRCm39) probably benign Het
Cyp24a1 T C 2: 170,333,589 (GRCm39) T255A possibly damaging Het
Dlg5 A G 14: 24,210,336 (GRCm39) S787P possibly damaging Het
Dnah6 A T 6: 73,014,549 (GRCm39) C3679* probably null Het
Dpy19l3 T C 7: 35,429,155 (GRCm39) Y95C probably damaging Het
Erc2 G A 14: 28,024,972 (GRCm39) probably null Het
Ezh2 A T 6: 47,509,834 (GRCm39) probably null Het
Fgfr1 A G 8: 26,060,258 (GRCm39) T463A probably damaging Het
Flvcr2 GTAGTGTATA GTA 12: 85,849,922 (GRCm39) probably null Het
Fsip2 T C 2: 82,820,808 (GRCm39) S5514P possibly damaging Het
Glrb A G 3: 80,758,373 (GRCm39) Y347H probably damaging Het
Gm14325 C A 2: 177,474,767 (GRCm39) C105F probably damaging Het
Hgsnat T C 8: 26,444,665 (GRCm39) T428A probably damaging Het
Ighv1-76 T C 12: 115,811,934 (GRCm39) M1V probably null Het
Inppl1 A G 7: 101,472,783 (GRCm39) I1207T possibly damaging Het
Kmt2c T A 5: 25,519,537 (GRCm39) Q2191L probably damaging Het
Krt79 T A 15: 101,848,705 (GRCm39) probably null Het
Mast4 G A 13: 102,872,247 (GRCm39) L2374F probably damaging Het
Mgam A G 6: 40,657,169 (GRCm39) N951S probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Naip6 A T 13: 100,431,344 (GRCm39) C1164* probably null Het
Nfatc2ip G T 7: 125,989,906 (GRCm39) D189E probably damaging Het
Nrp1 A G 8: 129,184,438 (GRCm39) D361G probably damaging Het
Nrp2 T C 1: 62,786,374 (GRCm39) I293T probably damaging Het
Pate5 A T 9: 35,750,719 (GRCm39) F34L possibly damaging Het
Pde3a T C 6: 141,433,611 (GRCm39) V831A probably damaging Het
Pirb A G 7: 3,715,905 (GRCm39) probably null Het
Plch1 G T 3: 63,610,047 (GRCm39) probably null Het
Plekhh2 A G 17: 84,898,277 (GRCm39) T973A possibly damaging Het
Ppp1r35 T A 5: 137,778,296 (GRCm39) I97K unknown Het
Ppp1r3c C T 19: 36,710,846 (GRCm39) G308E probably benign Het
Prss12 G A 3: 123,258,611 (GRCm39) probably null Het
Rad51b A G 12: 79,361,715 (GRCm39) D142G probably damaging Het
Slc13a3 C T 2: 165,248,745 (GRCm39) G553D probably damaging Het
Spata31d1d A C 13: 59,879,344 (GRCm39) V64G probably benign Het
Srp68 G A 11: 116,164,809 (GRCm39) R42C probably damaging Het
Syne2 T C 12: 76,062,365 (GRCm39) V4229A probably benign Het
Tas2r144 G A 6: 42,192,325 (GRCm39) V22M probably damaging Het
Tcf7l1 A G 6: 72,604,395 (GRCm39) L583P probably damaging Het
Tdrd3 A G 14: 87,749,214 (GRCm39) D708G probably benign Het
Tns4 A T 11: 98,976,627 (GRCm39) L98Q probably damaging Het
Zfp677 T A 17: 21,612,717 (GRCm39) probably null Het
Other mutations in Cripto
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02457:Cripto APN 9 110,771,691 (GRCm39) missense probably damaging 1.00
IGL03037:Cripto APN 9 110,772,288 (GRCm39) missense probably benign 0.23
R1171:Cripto UTSW 9 110,772,235 (GRCm39) missense probably benign 0.37
R3792:Cripto UTSW 9 110,772,258 (GRCm39) missense probably benign 0.02
R4012:Cripto UTSW 9 110,769,781 (GRCm39) missense probably benign
R5488:Cripto UTSW 9 110,772,265 (GRCm39) missense probably benign 0.01
R5955:Cripto UTSW 9 110,773,281 (GRCm39) missense unknown
R6536:Cripto UTSW 9 110,773,257 (GRCm39) critical splice donor site probably null
R7624:Cripto UTSW 9 110,775,017 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- AACCATACAGGGGTGGCTTG -3'
(R):5'- CAATCACACAGTCACTCTACATGTG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAAG -3'
(R):5'- GGCACCAGATCTCATTTTAGATGG -3'
Posted On 2020-07-13