Incidental Mutation 'R8206:Atpaf2'
ID 635924
Institutional Source Beutler Lab
Gene Symbol Atpaf2
Ensembl Gene ENSMUSG00000042709
Gene Name ATP synthase mitochondrial F1 complex assembly factor 2
Synonyms ATP12p, ATP12
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8206 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 60400626-60418457 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60404478 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 182 (I182T)
Ref Sequence ENSEMBL: ENSMUSP00000104361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108721] [ENSMUST00000145532]
AlphaFold Q91YY4
Predicted Effect probably damaging
Transcript: ENSMUST00000108721
AA Change: I182T

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104361
Gene: ENSMUSG00000042709
AA Change: I182T

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Pfam:ATP12 56 177 7.9e-43 PFAM
low complexity region 227 237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145532
SMART Domains Protein: ENSMUSP00000135761
Gene: ENSMUSG00000042709

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Pfam:ATP12 56 154 9.3e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an assembly factor for the F(1) component of the mitochondrial ATP synthase. This protein binds specifically to the F1 alpha subunit and is thought to prevent this subunit from forming nonproductive homooligomers during enzyme assembly. This gene is located within the Smith-Magenis syndrome region on chromosome 17. An alternatively spliced transcript variant has been described, but its biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cep63 A G 9: 102,621,271 probably benign Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Flvcr2 GTAGTGTATA GTA 12: 85,803,148 probably null Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r35 T A 5: 137,780,034 I97K unknown Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Atpaf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Atpaf2 APN 11 60409584 critical splice donor site probably null
IGL00504:Atpaf2 APN 11 60405803 missense probably damaging 1.00
IGL01941:Atpaf2 APN 11 60403898 missense probably benign 0.01
IGL02960:Atpaf2 APN 11 60405824 missense probably damaging 0.99
IGL03082:Atpaf2 APN 11 60403844 missense probably damaging 0.99
R1103:Atpaf2 UTSW 11 60403950 missense probably benign 0.06
R4782:Atpaf2 UTSW 11 60404412 missense probably damaging 0.99
R5180:Atpaf2 UTSW 11 60405869 missense possibly damaging 0.69
R5569:Atpaf2 UTSW 11 60416880 missense probably damaging 0.98
R5947:Atpaf2 UTSW 11 60405882 splice site probably benign
R6388:Atpaf2 UTSW 11 60417007 start gained probably benign
R8359:Atpaf2 UTSW 11 60407303 missense probably damaging 1.00
Z1176:Atpaf2 UTSW 11 60416775 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCATGCTCAAGAGGACTCAAG -3'
(R):5'- GGCATCCTGTGAGGGACTATTTTC -3'

Sequencing Primer
(F):5'- GAGGGATGTGTCACTAGGTACCC -3'
(R):5'- CAGCCTTCTGAGTGCTGTGATC -3'
Posted On 2020-07-13