Incidental Mutation 'R8206:Tns4'
ID 635925
Institutional Source Beutler Lab
Gene Symbol Tns4
Ensembl Gene ENSMUSG00000017607
Gene Name tensin 4
Synonyms 9930017A07Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.253) question?
Stock # R8206 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 99065678-99089306 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 99085801 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 98 (L98Q)
Ref Sequence ENSEMBL: ENSMUSP00000017751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017751]
AlphaFold Q8BZ33
Predicted Effect probably damaging
Transcript: ENSMUST00000017751
AA Change: L98Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017751
Gene: ENSMUSG00000017607
AA Change: L98Q

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 271 304 N/A INTRINSIC
SH2 427 527 6.95e-18 SMART
Pfam:PTB 562 695 1.6e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cep63 A G 9: 102,621,271 probably benign Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r35 T A 5: 137,780,034 I97K unknown Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Tns4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Tns4 APN 11 99070395 splice site probably benign
IGL01940:Tns4 APN 11 99068221 missense probably benign 0.43
IGL03130:Tns4 APN 11 99068269 missense probably damaging 1.00
IGL03376:Tns4 APN 11 99078556 missense probably benign 0.00
PIT4486001:Tns4 UTSW 11 99071335 missense probably damaging 1.00
R0089:Tns4 UTSW 11 99075198 missense probably damaging 1.00
R1598:Tns4 UTSW 11 99070417 missense probably damaging 1.00
R1872:Tns4 UTSW 11 99080100 missense probably damaging 1.00
R1903:Tns4 UTSW 11 99075575 missense probably damaging 1.00
R1998:Tns4 UTSW 11 99085703 missense probably benign
R2126:Tns4 UTSW 11 99080078 critical splice donor site probably null
R4468:Tns4 UTSW 11 99070415 missense probably benign 0.41
R4973:Tns4 UTSW 11 99075213 missense probably damaging 1.00
R5048:Tns4 UTSW 11 99078779 missense possibly damaging 0.95
R5918:Tns4 UTSW 11 99073671 critical splice donor site probably null
R6088:Tns4 UTSW 11 99073720 missense probably damaging 1.00
R6151:Tns4 UTSW 11 99075550 missense probably benign 0.11
R6586:Tns4 UTSW 11 99080267 missense probably benign 0.00
R7543:Tns4 UTSW 11 99072253 missense probably benign 0.38
R7667:Tns4 UTSW 11 99071470 missense probably damaging 1.00
R7909:Tns4 UTSW 11 99086023 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCTCAGAGTCTGTAGAAGAG -3'
(R):5'- ACTACACCACAGAGAGCTGG -3'

Sequencing Primer
(F):5'- CAGAGTCTGTAGAAGAGCTCTTATC -3'
(R):5'- GAAGCCAGAGCTCACTG -3'
Posted On 2020-07-13