Mutagenetix > Incidental Mutation

Incidental Mutation 'R8206:Tns4'

635925

Institutional Source

Beutler Lab

Gene Symbol

Tns4

Ensembl Gene

ENSMUSG00000017607

Gene Name

tensin 4

Synonyms

9930017A07Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.253) question?

Stock #

R8206 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

99065678-99089306 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 99085801 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 98 (L98Q)

Ref Sequence

ENSEMBL: ENSMUSP00000017751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017751]

AlphaFold

Q8BZ33

Predicted Effect

probably damaging
Transcript: ENSMUST00000017751
AA Change: L98Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000017751
Gene: ENSMUSG00000017607
AA Change: L98Q

Domain	Start	End	E-Value	Type
low complexity region	63	72	N/A	INTRINSIC
low complexity region	271	304	N/A	INTRINSIC
SH2	427	527	6.95e-18	SMART
Pfam:PTB	562	695	1.6e-31	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (50/50)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	A	T	9: 35,839,423	F34L	possibly damaging	Het
Ano4	A	G	10: 89,025,096	Y342H	probably damaging	Het
Aqp4	T	A	18: 15,393,659	D255V	possibly damaging	Het
Arhgap26	C	A	18: 39,306,750	S247*	probably null	Het
Arid4a	A	G	12: 71,086,587	D1154G	probably damaging	Het
Atpaf2	A	G	11: 60,404,478	I182T	probably damaging	Het
Cacna1i	C	A	15: 80,389,815		probably null	Het
Ccdc38	A	G	10: 93,563,284	S205G	probably damaging	Het
Cep63	A	G	9: 102,621,271		probably benign	Het
Cyp24a1	T	C	2: 170,491,669	T255A	possibly damaging	Het
Dlg5	A	G	14: 24,160,268	S787P	possibly damaging	Het
Dnah6	A	T	6: 73,037,566	C3679*	probably null	Het
Dpy19l3	T	C	7: 35,729,730	Y95C	probably damaging	Het
Erc2	G	A	14: 28,303,015		probably null	Het
Ezh2	A	T	6: 47,532,900		probably null	Het
Fgfr1	A	G	8: 25,570,242	T463A	probably damaging	Het
Fsip2	T	C	2: 82,990,464	S5514P	possibly damaging	Het
Glrb	A	G	3: 80,851,066	Y347H	probably damaging	Het
Gm14325	C	A	2: 177,832,974	C105F	probably damaging	Het
Hgsnat	T	C	8: 25,954,637	T428A	probably damaging	Het
Ighv1-76	T	C	12: 115,848,314	M1V	probably null	Het
Inppl1	A	G	7: 101,823,576	I1207T	possibly damaging	Het
Kmt2c	T	A	5: 25,314,539	Q2191L	probably damaging	Het
Krt79	T	A	15: 101,940,270		probably null	Het
Mast4	G	A	13: 102,735,739	L2374F	probably damaging	Het
Mfsd7c	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Mgam	A	G	6: 40,680,235	N951S	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naip6	A	T	13: 100,294,836	C1164*	probably null	Het
Nfatc2ip	G	T	7: 126,390,734	D189E	probably damaging	Het
Nrp1	A	G	8: 128,457,957	D361G	probably damaging	Het
Nrp2	T	C	1: 62,747,215	I293T	probably damaging	Het
Pde3a	T	C	6: 141,487,885	V831A	probably damaging	Het
Pirb	A	G	7: 3,712,906		probably null	Het
Plch1	G	T	3: 63,702,626		probably null	Het
Plekhh2	A	G	17: 84,590,849	T973A	possibly damaging	Het
Ppp1r35	T	A	5: 137,780,034	I97K	unknown	Het
Ppp1r3c	C	T	19: 36,733,446	G308E	probably benign	Het
Prss12	G	A	3: 123,464,962		probably null	Het
Rad51b	A	G	12: 79,314,941	D142G	probably damaging	Het
Slc13a3	C	T	2: 165,406,825	G553D	probably damaging	Het
Spata31d1d	A	C	13: 59,731,530	V64G	probably benign	Het
Srp68	G	A	11: 116,273,983	R42C	probably damaging	Het
Syne2	T	C	12: 76,015,591	V4229A	probably benign	Het
Tas2r144	G	A	6: 42,215,391	V22M	probably damaging	Het
Tcf7l1	A	G	6: 72,627,412	L583P	probably damaging	Het
Tdgf1	G	A	9: 110,944,284		probably benign	Het
Tdrd3	A	G	14: 87,511,778	D708G	probably benign	Het
Zfp677	T	A	17: 21,392,455		probably null	Het

Other mutations in Tns4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00783:Tns4	APN	11	99070395	splice site	probably benign
IGL01940:Tns4	APN	11	99068221	missense	probably benign	0.43
IGL03130:Tns4	APN	11	99068269	missense	probably damaging	1.00
IGL03376:Tns4	APN	11	99078556	missense	probably benign	0.00
PIT4486001:Tns4	UTSW	11	99071335	missense	probably damaging	1.00
R0089:Tns4	UTSW	11	99075198	missense	probably damaging	1.00
R1598:Tns4	UTSW	11	99070417	missense	probably damaging	1.00
R1872:Tns4	UTSW	11	99080100	missense	probably damaging	1.00
R1903:Tns4	UTSW	11	99075575	missense	probably damaging	1.00
R1998:Tns4	UTSW	11	99085703	missense	probably benign
R2126:Tns4	UTSW	11	99080078	critical splice donor site	probably null
R4468:Tns4	UTSW	11	99070415	missense	probably benign	0.41
R4973:Tns4	UTSW	11	99075213	missense	probably damaging	1.00
R5048:Tns4	UTSW	11	99078779	missense	possibly damaging	0.95
R5918:Tns4	UTSW	11	99073671	critical splice donor site	probably null
R6088:Tns4	UTSW	11	99073720	missense	probably damaging	1.00
R6151:Tns4	UTSW	11	99075550	missense	probably benign	0.11
R6586:Tns4	UTSW	11	99080267	missense	probably benign	0.00
R7543:Tns4	UTSW	11	99072253	missense	probably benign	0.38
R7667:Tns4	UTSW	11	99071470	missense	probably damaging	1.00
R7909:Tns4	UTSW	11	99086023	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCCTCAGAGTCTGTAGAAGAG -3'
(R):5'- ACTACACCACAGAGAGCTGG -3'

Sequencing Primer
(F):5'- CAGAGTCTGTAGAAGAGCTCTTATC -3'
(R):5'- GAAGCCAGAGCTCACTG -3'

Posted On

2020-07-13