Incidental Mutation 'R8206:Srp68'
ID635926
Institutional Source Beutler Lab
Gene Symbol Srp68
Ensembl Gene ENSMUSG00000020780
Gene Namesignal recognition particle 68
Synonyms2610024I03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R8206 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116245166-116274217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116273983 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 42 (R42C)
Ref Sequence ENSEMBL: ENSMUSP00000021133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021133] [ENSMUST00000106425]
Predicted Effect probably damaging
Transcript: ENSMUST00000021133
AA Change: R42C

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021133
Gene: ENSMUSG00000020780
AA Change: R42C

DomainStartEndE-ValueType
low complexity region 9 34 N/A INTRINSIC
Pfam:SRP68 74 596 5.5e-156 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106425
AA Change: R42C

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102033
Gene: ENSMUSG00000020780
AA Change: R42C

DomainStartEndE-ValueType
low complexity region 9 34 N/A INTRINSIC
PDB:4P3F|B 46 215 1e-112 PDB
Blast:TPR 149 182 5e-15 BLAST
Blast:TPR 424 457 1e-14 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the signal recognition particle (SRP). The SRP is a ribonucleoprotein complex that transports secreted and membrane proteins to the endoplasmic reticulum for processing. The complex includes a 7S RNA and six protein subunits. The encoded protein is the 68kDa component of the SRP, and forms a heterodimer with the 72kDa subunit that is required for SRP function. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and three pseudogenes of this gene are located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cep63 A G 9: 102,621,271 probably benign Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r35 T A 5: 137,780,034 I97K unknown Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Srp68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Srp68 APN 11 116247812 splice site probably benign
IGL02974:Srp68 APN 11 116246225 missense probably benign 0.31
tipsy UTSW 11 116245812 missense probably damaging 1.00
P0028:Srp68 UTSW 11 116260920 missense probably damaging 0.99
R0211:Srp68 UTSW 11 116265551 missense probably damaging 1.00
R0211:Srp68 UTSW 11 116265551 missense probably damaging 1.00
R0468:Srp68 UTSW 11 116248764 missense probably damaging 0.98
R0796:Srp68 UTSW 11 116246683 missense probably benign 0.12
R1291:Srp68 UTSW 11 116263281 missense probably damaging 1.00
R1906:Srp68 UTSW 11 116250761 missense probably damaging 1.00
R2149:Srp68 UTSW 11 116260867 missense possibly damaging 0.93
R3732:Srp68 UTSW 11 116273956 nonsense probably null
R4651:Srp68 UTSW 11 116274014 missense probably benign
R4652:Srp68 UTSW 11 116274014 missense probably benign
R4686:Srp68 UTSW 11 116265401 missense probably damaging 0.98
R4924:Srp68 UTSW 11 116260858 missense probably damaging 1.00
R5077:Srp68 UTSW 11 116245812 missense probably damaging 1.00
R5095:Srp68 UTSW 11 116248747 missense probably damaging 0.98
R5166:Srp68 UTSW 11 116265474 missense probably damaging 0.99
R5167:Srp68 UTSW 11 116265474 missense probably damaging 0.99
R5168:Srp68 UTSW 11 116265474 missense probably damaging 0.99
R5769:Srp68 UTSW 11 116246669 missense probably damaging 1.00
R6379:Srp68 UTSW 11 116265401 missense probably damaging 1.00
R6577:Srp68 UTSW 11 116265464 missense probably damaging 1.00
R6777:Srp68 UTSW 11 116262904 missense probably damaging 1.00
R7089:Srp68 UTSW 11 116271907 splice site probably null
R7561:Srp68 UTSW 11 116248767 missense probably damaging 0.99
R7823:Srp68 UTSW 11 116265439 missense probably damaging 1.00
R7854:Srp68 UTSW 11 116254083 splice site probably null
R8407:Srp68 UTSW 11 116252763 missense probably benign 0.00
Z1088:Srp68 UTSW 11 116274035 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AACCATGCACACGGGAATG -3'
(R):5'- AGTCCGTCAGTGTACCATCG -3'

Sequencing Primer
(F):5'- CACACGGGAATGCCGAAAGTG -3'
(R):5'- TGGAAAGTGCCGCTCTCTC -3'
Posted On2020-07-13