Incidental Mutation 'R8206:Rad51b'
ID635929
Institutional Source Beutler Lab
Gene Symbol Rad51b
Ensembl Gene ENSMUSG00000059060
Gene NameRAD51 paralog B
SynonymsmREC2, R51H2, Rad51b
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8206 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location79297282-79814690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79314941 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 142 (D142G)
Ref Sequence ENSEMBL: ENSMUSP00000078490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079533] [ENSMUST00000171210]
Predicted Effect probably damaging
Transcript: ENSMUST00000079533
AA Change: D142G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078490
Gene: ENSMUSG00000059060
AA Change: D142G

DomainStartEndE-ValueType
Pfam:Rad51 61 256 3.1e-32 PFAM
Pfam:AAA_25 68 249 1.1e-15 PFAM
Pfam:KaiC 83 240 1.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171210
AA Change: D142G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128357
Gene: ENSMUSG00000059060
AA Change: D142G

DomainStartEndE-ValueType
Pfam:Rad51 61 256 3e-33 PFAM
Pfam:AAA_25 68 241 2.8e-16 PFAM
Pfam:KaiC 83 241 3.6e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are evolutionarily conserved proteins essential for DNA repair by homologous recombination. This protein has been shown to form a stable heterodimer with the family member RAD51C, which further interacts with the other family members, such as RAD51, XRCC2, and XRCC3. Overexpression of this gene was found to cause cell cycle G1 delay and cell apoptosis, which suggested a role of this protein in sensing DNA damage. Rearrangements between this locus and high mobility group AT-hook 2 (HMGA2, GeneID 8091) have been observed in uterine leiomyomata. [provided by RefSeq, Mar 2016]
PHENOTYPE: Embryos homozygous for a knock-out allele are severely growth retarded and exhibit complete early embryonic lethality; interestingly, mutant embryos survive and develop further in a Trp53-null background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cep63 A G 9: 102,621,271 probably benign Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r35 T A 5: 137,780,034 I97K unknown Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Rad51b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Rad51b APN 12 79302553 missense probably benign 0.00
IGL01599:Rad51b APN 12 79327228 missense probably benign 0.30
IGL02955:Rad51b APN 12 79325082 nonsense probably null
R1544:Rad51b UTSW 12 79302543 missense possibly damaging 0.87
R2998:Rad51b UTSW 12 79302489 missense probably damaging 1.00
R3784:Rad51b UTSW 12 79300645 nonsense probably null
R4076:Rad51b UTSW 12 79314882 missense probably damaging 1.00
R5916:Rad51b UTSW 12 79325082 nonsense probably null
R7489:Rad51b UTSW 12 79300585 nonsense probably null
R7765:Rad51b UTSW 12 79803270 critical splice donor site probably null
R8160:Rad51b UTSW 12 79303341 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCATTTGTCAACAGGAGAAC -3'
(R):5'- AAACCTGATCCGCTTCCTGG -3'

Sequencing Primer
(F):5'- CTTCCAACCAAGGTTATGGGATTGC -3'
(R):5'- CGCTTCCTGGATCGATTTCAAAAGG -3'
Posted On2020-07-13