Incidental Mutation 'R8206:Mfsd7c'
ID635930
Institutional Source Beutler Lab
Gene Symbol Mfsd7c
Ensembl Gene ENSMUSG00000034258
Gene Name
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.843) question?
Stock #R8206 (G1)
Quality Score217.468
Status Validated
Chromosome12
Chromosomal Location (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GTAGTGTATA to GTA at 85803148 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040461]
Predicted Effect probably null
Transcript: ENSMUST00000040461
SMART Domains Protein: ENSMUSP00000035569
Gene: ENSMUSG00000034258

DomainStartEndE-ValueType
Pfam:MFS_1 113 477 1.7e-30 PFAM
transmembrane domain 488 510 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cep63 A G 9: 102,621,271 probably benign Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r35 T A 5: 137,780,034 I97K unknown Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Mfsd7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R8200:Mfsd7c UTSW 12 85803148 frame shift probably null
R8203:Mfsd7c UTSW 12 85803148 frame shift probably null
R8204:Mfsd7c UTSW 12 85803148 frame shift probably null
R8207:Mfsd7c UTSW 12 85803148 frame shift probably null
R8208:Mfsd7c UTSW 12 85803148 frame shift probably null
R8217:Mfsd7c UTSW 12 85803148 frame shift probably null
R8218:Mfsd7c UTSW 12 85803148 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTCTTTGAAACATTGGTCATGGTG -3'
(R):5'- TTTCACATCTCCTGAGGCCAG -3'

Sequencing Primer
(F):5'- AGTGTTCCTCACCTATATGGAGACAC -3'
(R):5'- GGGACTTGCATTGCCTCCTAG -3'
Posted On2020-07-13