Mutagenetix > Incidental Mutation

Incidental Mutation 'R8206:Spata31d1d'

635932

Institutional Source

Beutler Lab

Gene Symbol

Spata31d1d

Ensembl Gene

ENSMUSG00000043986

Gene Name

spermatogenesis associated 31 subfamily D, member 1D

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8206 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59725925-59731752 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 59731530 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 64 (V64G)

Ref Sequence

ENSEMBL: ENSMUSP00000128200 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052978]

AlphaFold

E9Q5W2

Predicted Effect

probably benign
Transcript: ENSMUST00000052978
AA Change: V64G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000128200
Gene: ENSMUSG00000043986
AA Change: V64G

Domain	Start	End	E-Value	Type
transmembrane domain	21	43	N/A	INTRINSIC
Pfam:DUF4599	70	155	5.4e-28	PFAM
low complexity region	228	238	N/A	INTRINSIC
low complexity region	284	298	N/A	INTRINSIC
Pfam:FAM75	383	733	2.6e-93	PFAM
low complexity region	1017	1030	N/A	INTRINSIC
low complexity region	1111	1129	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (50/50)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	A	T	9: 35,839,423	F34L	possibly damaging	Het
Ano4	A	G	10: 89,025,096	Y342H	probably damaging	Het
Aqp4	T	A	18: 15,393,659	D255V	possibly damaging	Het
Arhgap26	C	A	18: 39,306,750	S247*	probably null	Het
Arid4a	A	G	12: 71,086,587	D1154G	probably damaging	Het
Atpaf2	A	G	11: 60,404,478	I182T	probably damaging	Het
Cacna1i	C	A	15: 80,389,815		probably null	Het
Ccdc38	A	G	10: 93,563,284	S205G	probably damaging	Het
Cep63	A	G	9: 102,621,271		probably benign	Het
Cyp24a1	T	C	2: 170,491,669	T255A	possibly damaging	Het
Dlg5	A	G	14: 24,160,268	S787P	possibly damaging	Het
Dnah6	A	T	6: 73,037,566	C3679*	probably null	Het
Dpy19l3	T	C	7: 35,729,730	Y95C	probably damaging	Het
Erc2	G	A	14: 28,303,015		probably null	Het
Ezh2	A	T	6: 47,532,900		probably null	Het
Fgfr1	A	G	8: 25,570,242	T463A	probably damaging	Het
Flvcr2	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Fsip2	T	C	2: 82,990,464	S5514P	possibly damaging	Het
Glrb	A	G	3: 80,851,066	Y347H	probably damaging	Het
Gm14325	C	A	2: 177,832,974	C105F	probably damaging	Het
Hgsnat	T	C	8: 25,954,637	T428A	probably damaging	Het
Ighv1-76	T	C	12: 115,848,314	M1V	probably null	Het
Inppl1	A	G	7: 101,823,576	I1207T	possibly damaging	Het
Kmt2c	T	A	5: 25,314,539	Q2191L	probably damaging	Het
Krt79	T	A	15: 101,940,270		probably null	Het
Mast4	G	A	13: 102,735,739	L2374F	probably damaging	Het
Mgam	A	G	6: 40,680,235	N951S	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naip6	A	T	13: 100,294,836	C1164*	probably null	Het
Nfatc2ip	G	T	7: 126,390,734	D189E	probably damaging	Het
Nrp1	A	G	8: 128,457,957	D361G	probably damaging	Het
Nrp2	T	C	1: 62,747,215	I293T	probably damaging	Het
Pde3a	T	C	6: 141,487,885	V831A	probably damaging	Het
Pirb	A	G	7: 3,712,906		probably null	Het
Plch1	G	T	3: 63,702,626		probably null	Het
Plekhh2	A	G	17: 84,590,849	T973A	possibly damaging	Het
Ppp1r35	T	A	5: 137,780,034	I97K	unknown	Het
Ppp1r3c	C	T	19: 36,733,446	G308E	probably benign	Het
Prss12	G	A	3: 123,464,962		probably null	Het
Rad51b	A	G	12: 79,314,941	D142G	probably damaging	Het
Slc13a3	C	T	2: 165,406,825	G553D	probably damaging	Het
Srp68	G	A	11: 116,273,983	R42C	probably damaging	Het
Syne2	T	C	12: 76,015,591	V4229A	probably benign	Het
Tas2r144	G	A	6: 42,215,391	V22M	probably damaging	Het
Tcf7l1	A	G	6: 72,627,412	L583P	probably damaging	Het
Tdgf1	G	A	9: 110,944,284		probably benign	Het
Tdrd3	A	G	14: 87,511,778	D708G	probably benign	Het
Tns4	A	T	11: 99,085,801	L98Q	probably damaging	Het
Zfp677	T	A	17: 21,392,455		probably null	Het

Other mutations in Spata31d1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01474:Spata31d1d	APN	13	59730215	splice site	probably benign
IGL02399:Spata31d1d	APN	13	59730140	splice site	probably benign
IGL02531:Spata31d1d	APN	13	59727934	missense	possibly damaging	0.86
IGL02687:Spata31d1d	APN	13	59727864	missense	possibly damaging	0.71
IGL02815:Spata31d1d	APN	13	59726864	missense	possibly damaging	0.72
IGL02893:Spata31d1d	APN	13	59725979	missense	possibly damaging	0.72
IGL03037:Spata31d1d	APN	13	59726133	missense	possibly damaging	0.86
IGL02796:Spata31d1d	UTSW	13	59728243	missense	possibly damaging	0.93
R0612:Spata31d1d	UTSW	13	59727973	missense	probably benign	0.06
R1345:Spata31d1d	UTSW	13	59726024	missense	possibly damaging	0.72
R1572:Spata31d1d	UTSW	13	59728191	missense	probably benign	0.01
R1736:Spata31d1d	UTSW	13	59726497	missense	probably benign	0.02
R1750:Spata31d1d	UTSW	13	59728695	missense	probably benign	0.33
R1894:Spata31d1d	UTSW	13	59728122	missense	probably benign	0.09
R2202:Spata31d1d	UTSW	13	59731621	missense	possibly damaging	0.82
R2203:Spata31d1d	UTSW	13	59731621	missense	possibly damaging	0.82
R2204:Spata31d1d	UTSW	13	59731621	missense	possibly damaging	0.82
R2913:Spata31d1d	UTSW	13	59726955	missense	possibly damaging	0.72
R3942:Spata31d1d	UTSW	13	59727462	missense	probably benign	0.18
R4513:Spata31d1d	UTSW	13	59728554	missense	probably benign	0.32
R4824:Spata31d1d	UTSW	13	59729241	missense	possibly damaging	0.86
R4959:Spata31d1d	UTSW	13	59727288	missense	probably damaging	1.00
R4970:Spata31d1d	UTSW	13	59727520	missense	probably benign	0.33
R5406:Spata31d1d	UTSW	13	59728778	missense	probably benign	0.33
R5618:Spata31d1d	UTSW	13	59726400	missense	probably benign	0.01
R5688:Spata31d1d	UTSW	13	59726508	missense	probably damaging	0.98
R5741:Spata31d1d	UTSW	13	59728686	missense	possibly damaging	0.86
R5867:Spata31d1d	UTSW	13	59727240	missense	possibly damaging	0.53
R5930:Spata31d1d	UTSW	13	59727015	missense	probably benign
R6263:Spata31d1d	UTSW	13	59725983	missense	probably benign	0.18
R6267:Spata31d1d	UTSW	13	59728464	missense	possibly damaging	0.93
R6296:Spata31d1d	UTSW	13	59728464	missense	possibly damaging	0.93
R6597:Spata31d1d	UTSW	13	59726057	missense	probably benign	0.01
R6985:Spata31d1d	UTSW	13	59731615	missense	probably benign	0.00
R7032:Spata31d1d	UTSW	13	59728232	missense	probably benign
R7174:Spata31d1d	UTSW	13	59728580	missense	possibly damaging	0.72
R7322:Spata31d1d	UTSW	13	59726976	missense	probably benign
R7444:Spata31d1d	UTSW	13	59727193	missense	probably benign	0.33
R7946:Spata31d1d	UTSW	13	59730792	missense	probably benign	0.02
R8912:Spata31d1d	UTSW	13	59727322	missense	possibly damaging	0.53
R8995:Spata31d1d	UTSW	13	59726607	missense	probably benign	0.33
R9215:Spata31d1d	UTSW	13	59728009	missense	probably benign	0.32
R9800:Spata31d1d	UTSW	13	59726823	missense	possibly damaging	0.53
Z1176:Spata31d1d	UTSW	13	59726167	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- CAGATGAAACTAATGCCTTCCATC -3'
(R):5'- GCCCCTGAGATTCACACTATG -3'

Sequencing Primer
(F):5'- TGAAACTAATGCCTTCCATCCCAGG -3'
(R):5'- AAAGGTTCTCTCCATTCTCAATAGC -3'

Posted On

2020-07-13