Mutagenetix > Incidental Mutation

Incidental Mutation 'R8206:Dlg5'

635935

Institutional Source

Beutler Lab

Gene Symbol

Dlg5

Ensembl Gene

ENSMUSG00000021782

Gene Name

discs large MAGUK scaffold protein 5

Synonyms

4933429D20Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001163513; MGI: 1918478

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8206 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24133953-24245920 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24160268 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 787 (S787P)

Ref Sequence

ENSEMBL: ENSMUSP00000087879 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042009] [ENSMUST00000073687] [ENSMUST00000090398]

AlphaFold

E9Q9R9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042009
AA Change: S438P

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000044852
Gene: ENSMUSG00000021782
AA Change: S438P

Domain	Start	End	E-Value	Type
coiled coil region	20	247	N/A	INTRINSIC
low complexity region	261	274	N/A	INTRINSIC
PDZ	279	356	2.02e-10	SMART
PDZ	364	447	9.5e-16	SMART
low complexity region	510	517	N/A	INTRINSIC
low complexity region	692	711	N/A	INTRINSIC
low complexity region	903	918	N/A	INTRINSIC
PDZ	1009	1080	2.1e-17	SMART
PDZ	1164	1236	2.97e-8	SMART
SH3	1250	1314	3.73e-7	SMART
low complexity region	1338	1358	N/A	INTRINSIC
GuKc	1375	1561	5.43e-53	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000073687
AA Change: S764P

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000073367
Gene: ENSMUSG00000021782
AA Change: S764P

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	22	36	N/A	INTRINSIC
low complexity region	44	66	N/A	INTRINSIC
Pfam:Takusan	104	191	1.4e-27	PFAM
coiled coil region	308	578	N/A	INTRINSIC
low complexity region	592	605	N/A	INTRINSIC
PDZ	610	687	2.02e-10	SMART
PDZ	695	773	1.25e-15	SMART
low complexity region	836	843	N/A	INTRINSIC
low complexity region	1018	1037	N/A	INTRINSIC
low complexity region	1229	1244	N/A	INTRINSIC
PDZ	1335	1406	2.1e-17	SMART
PDZ	1490	1562	2.97e-8	SMART
SH3	1576	1640	3.73e-7	SMART
low complexity region	1664	1684	N/A	INTRINSIC
GuKc	1701	1887	5.43e-53	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090398
AA Change: S787P

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000087879
Gene: ENSMUSG00000021782
AA Change: S787P

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	22	36	N/A	INTRINSIC
low complexity region	44	66	N/A	INTRINSIC
low complexity region	109	123	N/A	INTRINSIC
Pfam:Takusan	128	213	6e-33	PFAM
coiled coil region	331	601	N/A	INTRINSIC
low complexity region	615	628	N/A	INTRINSIC
PDZ	633	710	2.02e-10	SMART
PDZ	718	796	1.25e-15	SMART
low complexity region	859	866	N/A	INTRINSIC
low complexity region	1041	1060	N/A	INTRINSIC
low complexity region	1252	1267	N/A	INTRINSIC
PDZ	1358	1429	2.1e-17	SMART
PDZ	1513	1585	2.97e-8	SMART
SH3	1599	1663	3.73e-7	SMART
low complexity region	1687	1707	N/A	INTRINSIC
GuKc	1724	1910	5.43e-53	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of discs large (DLG) homologs, a subset of the membrane-associated guanylate kinase (MAGUK) superfamily. The MAGUK proteins are composed of a catalytically inactive guanylate kinase domain, in addition to PDZ and SH3 domains, and are thought to function as scaffolding molecules at sites of cell-cell contact. The protein encoded by this gene localizes to the plasma membrane and cytoplasm, and interacts with components of adherens junctions and the cytoskeleton. It is proposed to function in the transmission of extracellular signals to the cytoskeleton and in the maintenance of epithelial cell structure. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit growth retardation, hydroencephaly, abnormal brain morphology, abnormal neurogenesis, kidney cysts, ureter defects, and abnormal kidney morphology. [provided by MGI curators]

Allele List at MGI

All alleles(19) : Targeted, other(1) Gene trapped(18)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	A	T	9: 35,839,423	F34L	possibly damaging	Het
Ano4	A	G	10: 89,025,096	Y342H	probably damaging	Het
Aqp4	T	A	18: 15,393,659	D255V	possibly damaging	Het
Arhgap26	C	A	18: 39,306,750	S247*	probably null	Het
Arid4a	A	G	12: 71,086,587	D1154G	probably damaging	Het
Atpaf2	A	G	11: 60,404,478	I182T	probably damaging	Het
Cacna1i	C	A	15: 80,389,815		probably null	Het
Ccdc38	A	G	10: 93,563,284	S205G	probably damaging	Het
Cep63	A	G	9: 102,621,271		probably benign	Het
Cyp24a1	T	C	2: 170,491,669	T255A	possibly damaging	Het
Dnah6	A	T	6: 73,037,566	C3679*	probably null	Het
Dpy19l3	T	C	7: 35,729,730	Y95C	probably damaging	Het
Erc2	G	A	14: 28,303,015		probably null	Het
Ezh2	A	T	6: 47,532,900		probably null	Het
Fgfr1	A	G	8: 25,570,242	T463A	probably damaging	Het
Flvcr2	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Fsip2	T	C	2: 82,990,464	S5514P	possibly damaging	Het
Glrb	A	G	3: 80,851,066	Y347H	probably damaging	Het
Gm14325	C	A	2: 177,832,974	C105F	probably damaging	Het
Hgsnat	T	C	8: 25,954,637	T428A	probably damaging	Het
Ighv1-76	T	C	12: 115,848,314	M1V	probably null	Het
Inppl1	A	G	7: 101,823,576	I1207T	possibly damaging	Het
Kmt2c	T	A	5: 25,314,539	Q2191L	probably damaging	Het
Krt79	T	A	15: 101,940,270		probably null	Het
Mast4	G	A	13: 102,735,739	L2374F	probably damaging	Het
Mgam	A	G	6: 40,680,235	N951S	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naip6	A	T	13: 100,294,836	C1164*	probably null	Het
Nfatc2ip	G	T	7: 126,390,734	D189E	probably damaging	Het
Nrp1	A	G	8: 128,457,957	D361G	probably damaging	Het
Nrp2	T	C	1: 62,747,215	I293T	probably damaging	Het
Pde3a	T	C	6: 141,487,885	V831A	probably damaging	Het
Pirb	A	G	7: 3,712,906		probably null	Het
Plch1	G	T	3: 63,702,626		probably null	Het
Plekhh2	A	G	17: 84,590,849	T973A	possibly damaging	Het
Ppp1r35	T	A	5: 137,780,034	I97K	unknown	Het
Ppp1r3c	C	T	19: 36,733,446	G308E	probably benign	Het
Prss12	G	A	3: 123,464,962		probably null	Het
Rad51b	A	G	12: 79,314,941	D142G	probably damaging	Het
Slc13a3	C	T	2: 165,406,825	G553D	probably damaging	Het
Spata31d1d	A	C	13: 59,731,530	V64G	probably benign	Het
Srp68	G	A	11: 116,273,983	R42C	probably damaging	Het
Syne2	T	C	12: 76,015,591	V4229A	probably benign	Het
Tas2r144	G	A	6: 42,215,391	V22M	probably damaging	Het
Tcf7l1	A	G	6: 72,627,412	L583P	probably damaging	Het
Tdgf1	G	A	9: 110,944,284		probably benign	Het
Tdrd3	A	G	14: 87,511,778	D708G	probably benign	Het
Tns4	A	T	11: 99,085,801	L98Q	probably damaging	Het
Zfp677	T	A	17: 21,392,455		probably null	Het

Other mutations in Dlg5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Dlg5	APN	14	24191161	missense	probably damaging	0.99
IGL00164:Dlg5	APN	14	24158464	missense	possibly damaging	0.89
IGL00767:Dlg5	APN	14	24165285	missense	probably damaging	1.00
IGL01284:Dlg5	APN	14	24146197	missense	probably damaging	1.00
IGL01328:Dlg5	APN	14	24202351	missense	probably damaging	0.98
IGL01532:Dlg5	APN	14	24158592	missense	probably benign
IGL01621:Dlg5	APN	14	24148221	missense	probably damaging	1.00
IGL01649:Dlg5	APN	14	24138691	missense	probably damaging	1.00
IGL01733:Dlg5	APN	14	24170449	missense	probably damaging	1.00
IGL02048:Dlg5	APN	14	24172203	missense	possibly damaging	0.87
IGL02103:Dlg5	APN	14	24144346	missense	probably damaging	1.00
IGL02138:Dlg5	APN	14	24158351	missense	probably benign
IGL02146:Dlg5	APN	14	24202361	missense	probably damaging	0.99
IGL02392:Dlg5	APN	14	24150209	missense	probably damaging	1.00
IGL02427:Dlg5	APN	14	24166207	missense	probably damaging	1.00
IGL02643:Dlg5	APN	14	24191182	missense	probably damaging	1.00
IGL02649:Dlg5	APN	14	24146251	missense	probably damaging	0.96
IGL02933:Dlg5	APN	14	24158499	missense	probably benign	0.06
IGL02965:Dlg5	APN	14	24172023	missense	probably damaging	1.00
IGL02988:Dlg5	APN	14	24166255	missense	probably damaging	1.00
IGL03351:Dlg5	APN	14	24170454	missense	probably benign	0.03
legerdemain	UTSW	14	24164547	missense	probably damaging	1.00
R0123:Dlg5	UTSW	14	24147206	missense	probably benign
R0131:Dlg5	UTSW	14	24138649	missense	probably damaging	1.00
R0709:Dlg5	UTSW	14	24146255	missense	probably damaging	1.00
R0920:Dlg5	UTSW	14	24176397	missense	probably damaging	1.00
R0924:Dlg5	UTSW	14	24135577	missense	probably damaging	1.00
R0930:Dlg5	UTSW	14	24135577	missense	probably damaging	1.00
R0981:Dlg5	UTSW	14	24154631	missense	probably damaging	1.00
R1402:Dlg5	UTSW	14	24176608	missense	probably benign	0.06
R1402:Dlg5	UTSW	14	24176608	missense	probably benign	0.06
R1438:Dlg5	UTSW	14	24154605	missense	possibly damaging	0.94
R1449:Dlg5	UTSW	14	24135643	missense	possibly damaging	0.82
R1465:Dlg5	UTSW	14	24154696	splice site	probably null
R1465:Dlg5	UTSW	14	24154696	splice site	probably null
R1543:Dlg5	UTSW	14	24144448	missense	probably damaging	1.00
R1824:Dlg5	UTSW	14	24149444	missense	probably benign	0.28
R1899:Dlg5	UTSW	14	24148300	missense	probably damaging	1.00
R1920:Dlg5	UTSW	14	24176571	missense	probably damaging	1.00
R1921:Dlg5	UTSW	14	24176571	missense	probably damaging	1.00
R1951:Dlg5	UTSW	14	24156469	splice site	probably benign
R1968:Dlg5	UTSW	14	24164119	nonsense	probably null
R2049:Dlg5	UTSW	14	24154647	missense	probably damaging	1.00
R2070:Dlg5	UTSW	14	24136635	missense	probably damaging	1.00
R2117:Dlg5	UTSW	14	24177758	nonsense	probably null
R2139:Dlg5	UTSW	14	24170544	missense	probably damaging	1.00
R2153:Dlg5	UTSW	14	24137157	missense	probably damaging	1.00
R2283:Dlg5	UTSW	14	24158663	missense	probably benign	0.00
R2293:Dlg5	UTSW	14	24158112	missense	probably benign
R2356:Dlg5	UTSW	14	24170428	critical splice donor site	probably null
R2362:Dlg5	UTSW	14	24158687	missense	probably benign	0.04
R2513:Dlg5	UTSW	14	24164525	missense	probably damaging	1.00
R3084:Dlg5	UTSW	14	24166190	missense	probably damaging	1.00
R3086:Dlg5	UTSW	14	24166190	missense	probably damaging	1.00
R3750:Dlg5	UTSW	14	24165260	missense	probably damaging	1.00
R3780:Dlg5	UTSW	14	24190310	unclassified	probably benign
R3782:Dlg5	UTSW	14	24190310	unclassified	probably benign
R3828:Dlg5	UTSW	14	24146158	missense	probably damaging	0.99
R4079:Dlg5	UTSW	14	24148260	missense	possibly damaging	0.94
R4393:Dlg5	UTSW	14	24177989	critical splice acceptor site	probably null
R4615:Dlg5	UTSW	14	24158168	missense	probably damaging	1.00
R4664:Dlg5	UTSW	14	24137181	missense	possibly damaging	0.90
R4712:Dlg5	UTSW	14	24177983	missense	possibly damaging	0.94
R4796:Dlg5	UTSW	14	24144383	missense	probably damaging	1.00
R4801:Dlg5	UTSW	14	24154689	missense	probably damaging	1.00
R4802:Dlg5	UTSW	14	24154689	missense	probably damaging	1.00
R4946:Dlg5	UTSW	14	24154361	missense	probably damaging	0.99
R5022:Dlg5	UTSW	14	24136622	missense	probably damaging	1.00
R5023:Dlg5	UTSW	14	24136622	missense	probably damaging	1.00
R5057:Dlg5	UTSW	14	24136622	missense	probably damaging	1.00
R5234:Dlg5	UTSW	14	24192862	missense	probably damaging	0.98
R5561:Dlg5	UTSW	14	24177792	missense	probably benign	0.03
R5567:Dlg5	UTSW	14	24192913	nonsense	probably null
R5570:Dlg5	UTSW	14	24192913	nonsense	probably null
R5640:Dlg5	UTSW	14	24170461	missense	probably damaging	1.00
R5646:Dlg5	UTSW	14	24158699	missense	probably damaging	1.00
R5711:Dlg5	UTSW	14	24150648	missense	probably damaging	1.00
R5810:Dlg5	UTSW	14	24146254	missense	probably damaging	0.99
R5900:Dlg5	UTSW	14	24149447	missense	probably damaging	1.00
R5964:Dlg5	UTSW	14	24164089	missense	probably benign
R6190:Dlg5	UTSW	14	24190438	missense	probably damaging	0.99
R6240:Dlg5	UTSW	14	24149528	splice site	probably null
R6276:Dlg5	UTSW	14	24164568	missense	probably damaging	1.00
R6339:Dlg5	UTSW	14	24158060	missense	probably damaging	1.00
R6508:Dlg5	UTSW	14	24138706	missense	probably benign	0.45
R6527:Dlg5	UTSW	14	24190448	missense	possibly damaging	0.73
R6593:Dlg5	UTSW	14	24150652	missense	probably benign	0.01
R6687:Dlg5	UTSW	14	24190373	missense	probably damaging	1.00
R6965:Dlg5	UTSW	14	24149430	missense	probably damaging	1.00
R7051:Dlg5	UTSW	14	24146195	missense	possibly damaging	0.93
R7075:Dlg5	UTSW	14	24177797	missense	possibly damaging	0.49
R7149:Dlg5	UTSW	14	24190424	missense	probably benign	0.00
R7182:Dlg5	UTSW	14	24244856	missense
R7203:Dlg5	UTSW	14	24138655	missense	probably damaging	1.00
R7216:Dlg5	UTSW	14	24136638	nonsense	probably null
R7359:Dlg5	UTSW	14	24164547	missense	probably damaging	1.00
R7466:Dlg5	UTSW	14	24245212	missense	probably damaging	1.00
R7485:Dlg5	UTSW	14	24148322	missense	probably benign
R7485:Dlg5	UTSW	14	24177839	missense	probably damaging	0.98
R7629:Dlg5	UTSW	14	24245212	missense	probably damaging	1.00
R7666:Dlg5	UTSW	14	24157799	missense	probably damaging	1.00
R7804:Dlg5	UTSW	14	24165320	missense	possibly damaging	0.46
R7861:Dlg5	UTSW	14	24245212	missense	probably damaging	1.00
R7862:Dlg5	UTSW	14	24245212	missense	probably damaging	1.00
R7864:Dlg5	UTSW	14	24245212	missense	probably damaging	1.00
R7874:Dlg5	UTSW	14	24135619	missense	probably damaging	1.00
R7913:Dlg5	UTSW	14	24137124	splice site	probably null
R7981:Dlg5	UTSW	14	24158145	missense	probably benign
R8147:Dlg5	UTSW	14	24158327	missense	probably benign	0.07
R8204:Dlg5	UTSW	14	24160252	missense	probably damaging	1.00
R8287:Dlg5	UTSW	14	24164385	missense	probably benign	0.40
R8296:Dlg5	UTSW	14	24148260	missense	possibly damaging	0.94
R8317:Dlg5	UTSW	14	24191230	missense	probably damaging	0.98
R8327:Dlg5	UTSW	14	24146320	missense	probably damaging	0.99
R8352:Dlg5	UTSW	14	24191193	missense	probably damaging	1.00
R8353:Dlg5	UTSW	14	24158145	missense	probably benign
R8409:Dlg5	UTSW	14	24176478	missense	probably damaging	1.00
R8452:Dlg5	UTSW	14	24191193	missense	probably damaging	1.00
R8453:Dlg5	UTSW	14	24158145	missense	probably benign
R8540:Dlg5	UTSW	14	24158699	missense	probably damaging	1.00
R8701:Dlg5	UTSW	14	24176700	missense	probably benign	0.04
R8925:Dlg5	UTSW	14	24156479	missense
R8927:Dlg5	UTSW	14	24156479	missense
R9025:Dlg5	UTSW	14	24149478	missense	probably benign	0.00
R9102:Dlg5	UTSW	14	24149499	missense	probably damaging	1.00
R9138:Dlg5	UTSW	14	24245308	missense	probably damaging	0.98
R9165:Dlg5	UTSW	14	24146241	missense	probably damaging	1.00
R9250:Dlg5	UTSW	14	24190475	missense	probably benign	0.07
R9267:Dlg5	UTSW	14	24154677	missense	probably damaging	1.00
R9269:Dlg5	UTSW	14	24192813	missense	probably damaging	0.99
R9291:Dlg5	UTSW	14	24191161	missense	probably damaging	0.99
R9387:Dlg5	UTSW	14	24147100	missense	probably damaging	0.99
R9729:Dlg5	UTSW	14	24154613	missense	probably benign	0.00
RF005:Dlg5	UTSW	14	24158493	nonsense	probably null
YA93:Dlg5	UTSW	14	24155133	unclassified	probably benign
Z1088:Dlg5	UTSW	14	24158094	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCGATTGAAATGTGCCCAG -3'
(R):5'- AGAGTCCTAGGATTGGCAGG -3'

Sequencing Primer
(F):5'- GAAATGTGCCCAGCTGTTC -3'
(R):5'- CCTAGGATTGGCAGGTGGGC -3'

Posted On

2020-07-13