Incidental Mutation 'R8206:Tdrd3'
ID635936
Institutional Source Beutler Lab
Gene Symbol Tdrd3
Ensembl Gene ENSMUSG00000022019
Gene Nametudor domain containing 3
Synonyms4732418C03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.440) question?
Stock #R8206 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location87416639-87545504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87511778 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 708 (D708G)
Ref Sequence ENSEMBL: ENSMUSP00000131542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168275] [ENSMUST00000169504] [ENSMUST00000170865]
Predicted Effect probably benign
Transcript: ENSMUST00000168275
SMART Domains Protein: ENSMUSP00000129019
Gene: ENSMUSG00000022019

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169504
AA Change: D708G

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131542
Gene: ENSMUSG00000022019
AA Change: D708G

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170865
SMART Domains Protein: ENSMUSP00000126189
Gene: ENSMUSG00000022019

DomainStartEndE-ValueType
DUF1767 3 82 1.36e-18 SMART
low complexity region 263 274 N/A INTRINSIC
UBA 282 319 1.67e-7 SMART
low complexity region 332 342 N/A INTRINSIC
low complexity region 440 454 N/A INTRINSIC
TUDOR 640 699 1.07e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Homozygous mice for a hypomorphic allele show increased genomic instability, and increased c-Myc/Igh translocation and R loop formation in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cep63 A G 9: 102,621,271 probably benign Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r35 T A 5: 137,780,034 I97K unknown Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Tdrd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Tdrd3 APN 14 87472182 missense probably damaging 1.00
IGL01339:Tdrd3 APN 14 87480794 missense possibly damaging 0.75
IGL01565:Tdrd3 APN 14 87472232 missense probably benign 0.01
IGL02505:Tdrd3 APN 14 87511682 missense probably damaging 1.00
R0121:Tdrd3 UTSW 14 87539479 missense probably damaging 1.00
R0550:Tdrd3 UTSW 14 87486220 missense probably damaging 1.00
R0648:Tdrd3 UTSW 14 87472182 missense probably damaging 1.00
R1080:Tdrd3 UTSW 14 87506398 missense probably benign 0.00
R1099:Tdrd3 UTSW 14 87487239 missense probably damaging 1.00
R1126:Tdrd3 UTSW 14 87480774 missense probably damaging 1.00
R1370:Tdrd3 UTSW 14 87458054 intron probably benign
R1592:Tdrd3 UTSW 14 87505886 missense probably damaging 1.00
R1881:Tdrd3 UTSW 14 87486347 splice site probably null
R2096:Tdrd3 UTSW 14 87506352 nonsense probably null
R2162:Tdrd3 UTSW 14 87480785 missense probably damaging 0.98
R3833:Tdrd3 UTSW 14 87480785 missense probably damaging 0.98
R3947:Tdrd3 UTSW 14 87506599 missense probably damaging 1.00
R4421:Tdrd3 UTSW 14 87486283 missense probably damaging 1.00
R4783:Tdrd3 UTSW 14 87472101 missense probably damaging 1.00
R4957:Tdrd3 UTSW 14 87505787 missense probably benign 0.06
R5212:Tdrd3 UTSW 14 87506215 missense probably damaging 0.98
R5291:Tdrd3 UTSW 14 87505798 missense probably benign 0.21
R5318:Tdrd3 UTSW 14 87477463 critical splice donor site probably null
R5383:Tdrd3 UTSW 14 87480791 nonsense probably null
R5718:Tdrd3 UTSW 14 87506440 missense probably benign 0.05
R6240:Tdrd3 UTSW 14 87505886 missense probably damaging 1.00
R6292:Tdrd3 UTSW 14 87506254 missense probably benign
R6532:Tdrd3 UTSW 14 87505816 missense probably damaging 0.98
R6850:Tdrd3 UTSW 14 87458079 intron probably benign
R6958:Tdrd3 UTSW 14 87457096 missense probably damaging 1.00
R7224:Tdrd3 UTSW 14 87477403 missense probably damaging 1.00
R7240:Tdrd3 UTSW 14 87458803 missense probably benign 0.06
R7565:Tdrd3 UTSW 14 87506593 nonsense probably null
R7818:Tdrd3 UTSW 14 87472200 missense probably damaging 1.00
R7861:Tdrd3 UTSW 14 87472154 missense probably damaging 1.00
R8108:Tdrd3 UTSW 14 87486266 missense possibly damaging 0.95
R8383:Tdrd3 UTSW 14 87506308 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCAGCACTGATGTCCTGTTTC -3'
(R):5'- CATGGAAGCAAGGGTATCTATTTCC -3'

Sequencing Primer
(F):5'- AGCACTGATGTCCTGTTTCAAATTTC -3'
(R):5'- GCAAGGGTATCTATTTCCAAAGC -3'
Posted On2020-07-13