Mutagenetix > Incidental Mutation

Incidental Mutation 'R8206:Krt79'

635937

Institutional Source

Beutler Lab

Gene Symbol

Krt79

Ensembl Gene

ENSMUSG00000061397

Gene Name

keratin 79

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8206 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101929332-101940324 bp(-) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

T to A at 101940270 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000023799 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023799]

AlphaFold

Q8VED5

Predicted Effect

probably null
Transcript: ENSMUST00000023799

SMART Domains

Protein: ENSMUSP00000023799
Gene: ENSMUSG00000061397

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	15	98	6.6e-11	PFAM
Pfam:Keratin_2_head	73	135	1.2e-21	PFAM
Filament	138	452	7.12e-159	SMART
low complexity region	474	500	N/A	INTRINSIC
low complexity region	519	530	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes an epithelial keratin that is expressed in skeletal muscle, skin and scalp. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	A	T	9: 35,839,423	F34L	possibly damaging	Het
Ano4	A	G	10: 89,025,096	Y342H	probably damaging	Het
Aqp4	T	A	18: 15,393,659	D255V	possibly damaging	Het
Arhgap26	C	A	18: 39,306,750	S247*	probably null	Het
Arid4a	A	G	12: 71,086,587	D1154G	probably damaging	Het
Atpaf2	A	G	11: 60,404,478	I182T	probably damaging	Het
Cacna1i	C	A	15: 80,389,815		probably null	Het
Ccdc38	A	G	10: 93,563,284	S205G	probably damaging	Het
Cep63	A	G	9: 102,621,271		probably benign	Het
Cyp24a1	T	C	2: 170,491,669	T255A	possibly damaging	Het
Dlg5	A	G	14: 24,160,268	S787P	possibly damaging	Het
Dnah6	A	T	6: 73,037,566	C3679*	probably null	Het
Dpy19l3	T	C	7: 35,729,730	Y95C	probably damaging	Het
Erc2	G	A	14: 28,303,015		probably null	Het
Ezh2	A	T	6: 47,532,900		probably null	Het
Fgfr1	A	G	8: 25,570,242	T463A	probably damaging	Het
Flvcr2	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Fsip2	T	C	2: 82,990,464	S5514P	possibly damaging	Het
Glrb	A	G	3: 80,851,066	Y347H	probably damaging	Het
Gm14325	C	A	2: 177,832,974	C105F	probably damaging	Het
Hgsnat	T	C	8: 25,954,637	T428A	probably damaging	Het
Ighv1-76	T	C	12: 115,848,314	M1V	probably null	Het
Inppl1	A	G	7: 101,823,576	I1207T	possibly damaging	Het
Kmt2c	T	A	5: 25,314,539	Q2191L	probably damaging	Het
Mast4	G	A	13: 102,735,739	L2374F	probably damaging	Het
Mgam	A	G	6: 40,680,235	N951S	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naip6	A	T	13: 100,294,836	C1164*	probably null	Het
Nfatc2ip	G	T	7: 126,390,734	D189E	probably damaging	Het
Nrp1	A	G	8: 128,457,957	D361G	probably damaging	Het
Nrp2	T	C	1: 62,747,215	I293T	probably damaging	Het
Pde3a	T	C	6: 141,487,885	V831A	probably damaging	Het
Pirb	A	G	7: 3,712,906		probably null	Het
Plch1	G	T	3: 63,702,626		probably null	Het
Plekhh2	A	G	17: 84,590,849	T973A	possibly damaging	Het
Ppp1r35	T	A	5: 137,780,034	I97K	unknown	Het
Ppp1r3c	C	T	19: 36,733,446	G308E	probably benign	Het
Prss12	G	A	3: 123,464,962		probably null	Het
Rad51b	A	G	12: 79,314,941	D142G	probably damaging	Het
Slc13a3	C	T	2: 165,406,825	G553D	probably damaging	Het
Spata31d1d	A	C	13: 59,731,530	V64G	probably benign	Het
Srp68	G	A	11: 116,273,983	R42C	probably damaging	Het
Syne2	T	C	12: 76,015,591	V4229A	probably benign	Het
Tas2r144	G	A	6: 42,215,391	V22M	probably damaging	Het
Tcf7l1	A	G	6: 72,627,412	L583P	probably damaging	Het
Tdgf1	G	A	9: 110,944,284		probably benign	Het
Tdrd3	A	G	14: 87,511,778	D708G	probably benign	Het
Tns4	A	T	11: 99,085,801	L98Q	probably damaging	Het
Zfp677	T	A	17: 21,392,455		probably null	Het

Other mutations in Krt79

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Krt79	APN	15	101940166	missense	probably damaging	0.98
IGL00546:Krt79	APN	15	101929873	missense	probably benign	0.00
IGL01595:Krt79	APN	15	101931771	missense	probably damaging	0.98
IGL02193:Krt79	APN	15	101939905	missense	possibly damaging	0.59
R0639:Krt79	UTSW	15	101931548	nonsense	probably null
R0980:Krt79	UTSW	15	101938007	missense	probably damaging	1.00
R1839:Krt79	UTSW	15	101937938	missense	possibly damaging	0.81
R4624:Krt79	UTSW	15	101939806	missense	possibly damaging	0.92
R4745:Krt79	UTSW	15	101930684	missense	probably damaging	1.00
R5203:Krt79	UTSW	15	101929740	missense	unknown
R5382:Krt79	UTSW	15	101931440	missense	probably benign	0.09
R5568:Krt79	UTSW	15	101929785	missense	probably damaging	0.99
R6902:Krt79	UTSW	15	101931879	missense	probably benign	0.08
R6916:Krt79	UTSW	15	101936170	missense	probably benign	0.01
R6998:Krt79	UTSW	15	101937872	missense	probably benign
R7009:Krt79	UTSW	15	101931441	missense	probably damaging	1.00
R7663:Krt79	UTSW	15	101931843	missense	probably damaging	0.97
R8161:Krt79	UTSW	15	101930702	missense	probably damaging	0.96
R8184:Krt79	UTSW	15	101929752	missense	unknown
R8705:Krt79	UTSW	15	101938006	missense	probably damaging	1.00
R8993:Krt79	UTSW	15	101931006	intron	probably benign
R9055:Krt79	UTSW	15	101931487	missense	probably damaging	1.00
R9322:Krt79	UTSW	15	101931810	missense	possibly damaging	0.92
R9456:Krt79	UTSW	15	101931469	missense	probably benign	0.02
R9495:Krt79	UTSW	15	101931853	missense	probably damaging	1.00
R9514:Krt79	UTSW	15	101931853	missense	probably damaging	1.00
R9533:Krt79	UTSW	15	101939982	missense	possibly damaging	0.55
R9560:Krt79	UTSW	15	101937842	missense	probably damaging	0.99
R9705:Krt79	UTSW	15	101930761	missense	probably benign
R9706:Krt79	UTSW	15	101930761	missense	probably benign
R9707:Krt79	UTSW	15	101930761	missense	probably benign
R9714:Krt79	UTSW	15	101930761	missense	probably benign
R9750:Krt79	UTSW	15	101930761	missense	probably benign
R9751:Krt79	UTSW	15	101930761	missense	probably benign
R9753:Krt79	UTSW	15	101930761	missense	probably benign
R9772:Krt79	UTSW	15	101930761	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTTGCCTCCCAAGTTGTAGAGG -3'
(R):5'- AGCACTTCAGTCTCAGTGATG -3'

Sequencing Primer
(F):5'- TCCCAAGTTGTAGAGGCTCCG -3'
(R):5'- GGTAATCACAGCTGGAGT -3'

Posted On

2020-07-13