Incidental Mutation 'R8206:Plekhh2'
ID635938
Institutional Source Beutler Lab
Gene Symbol Plekhh2
Ensembl Gene ENSMUSG00000040852
Gene Namepleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R8206 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location84511895-84622142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84590849 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 973 (T973A)
Ref Sequence ENSEMBL: ENSMUSP00000039628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047206]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047206
AA Change: T973A

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039628
Gene: ENSMUSG00000040852
AA Change: T973A

DomainStartEndE-ValueType
coiled coil region 19 84 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
coiled coil region 137 174 N/A INTRINSIC
low complexity region 427 442 N/A INTRINSIC
low complexity region 579 593 N/A INTRINSIC
low complexity region 612 651 N/A INTRINSIC
low complexity region 657 666 N/A INTRINSIC
PH 703 798 4.7e-19 SMART
PH 811 920 1.15e-4 SMART
MyTH4 954 1109 8.49e-39 SMART
B41 1116 1353 1.01e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cep63 A G 9: 102,621,271 probably benign Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Ppp1r35 T A 5: 137,780,034 I97K unknown Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Plekhh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Plekhh2 APN 17 84521775 missense probably benign 0.00
IGL00514:Plekhh2 APN 17 84596306 critical splice donor site probably null
IGL00773:Plekhh2 APN 17 84606868 missense probably benign 0.01
IGL00985:Plekhh2 APN 17 84563928 missense probably benign 0.00
IGL01116:Plekhh2 APN 17 84606928 missense possibly damaging 0.94
IGL01394:Plekhh2 APN 17 84557430 missense probably benign 0.24
IGL01419:Plekhh2 APN 17 84583552 splice site probably benign
IGL01932:Plekhh2 APN 17 84577261 missense probably benign 0.00
IGL02097:Plekhh2 APN 17 84599180 missense possibly damaging 0.69
IGL02157:Plekhh2 APN 17 84566942 splice site probably benign
IGL02163:Plekhh2 APN 17 84590795 missense probably benign 0.45
IGL02237:Plekhh2 APN 17 84575785 missense probably benign 0.00
IGL02322:Plekhh2 APN 17 84589466 nonsense probably null
IGL02422:Plekhh2 APN 17 84563809 splice site probably benign
IGL02483:Plekhh2 APN 17 84596260 missense possibly damaging 0.81
IGL02493:Plekhh2 APN 17 84606963 critical splice donor site probably null
IGL03007:Plekhh2 APN 17 84574960 missense possibly damaging 0.65
R0003:Plekhh2 UTSW 17 84557392 missense probably damaging 1.00
R0005:Plekhh2 UTSW 17 84586433 missense probably benign 0.16
R0099:Plekhh2 UTSW 17 84591672 nonsense probably null
R0331:Plekhh2 UTSW 17 84586366 missense possibly damaging 0.81
R0883:Plekhh2 UTSW 17 84618031 missense probably benign 0.11
R1051:Plekhh2 UTSW 17 84521827 critical splice donor site probably null
R1084:Plekhh2 UTSW 17 84571126 missense probably damaging 0.99
R1351:Plekhh2 UTSW 17 84577146 splice site probably benign
R1459:Plekhh2 UTSW 17 84610775 nonsense probably null
R1469:Plekhh2 UTSW 17 84575771 missense probably benign 0.03
R1469:Plekhh2 UTSW 17 84575771 missense probably benign 0.03
R1510:Plekhh2 UTSW 17 84559576 splice site probably null
R1699:Plekhh2 UTSW 17 84577184 nonsense probably null
R1738:Plekhh2 UTSW 17 84566697 missense possibly damaging 0.67
R1773:Plekhh2 UTSW 17 84599265 missense probably damaging 1.00
R1796:Plekhh2 UTSW 17 84599133 critical splice acceptor site probably null
R1823:Plekhh2 UTSW 17 84575189 missense probably damaging 1.00
R1998:Plekhh2 UTSW 17 84606877 missense possibly damaging 0.58
R2437:Plekhh2 UTSW 17 84586479 splice site probably null
R2847:Plekhh2 UTSW 17 84597966 missense probably damaging 1.00
R4088:Plekhh2 UTSW 17 84617999 missense probably benign 0.10
R4227:Plekhh2 UTSW 17 84566795 missense probably benign 0.00
R4249:Plekhh2 UTSW 17 84586337 missense possibly damaging 0.93
R4347:Plekhh2 UTSW 17 84619702 missense probably benign 0.12
R4562:Plekhh2 UTSW 17 84566097 missense probably benign 0.00
R4649:Plekhh2 UTSW 17 84575263 missense probably damaging 1.00
R4737:Plekhh2 UTSW 17 84563959 missense probably benign
R4743:Plekhh2 UTSW 17 84571120 missense probably damaging 1.00
R4858:Plekhh2 UTSW 17 84600697 missense probably damaging 1.00
R5036:Plekhh2 UTSW 17 84571761 missense probably damaging 0.99
R5260:Plekhh2 UTSW 17 84577165 missense probably damaging 0.99
R5385:Plekhh2 UTSW 17 84557466 missense probably benign 0.00
R5409:Plekhh2 UTSW 17 84586478 critical splice donor site probably null
R5510:Plekhh2 UTSW 17 84566847 missense probably benign
R5557:Plekhh2 UTSW 17 84560152 missense probably benign 0.10
R5684:Plekhh2 UTSW 17 84597918 missense probably damaging 1.00
R5685:Plekhh2 UTSW 17 84569882 missense probably damaging 1.00
R5724:Plekhh2 UTSW 17 84566805 missense probably benign 0.00
R5742:Plekhh2 UTSW 17 84597980 missense probably damaging 1.00
R5817:Plekhh2 UTSW 17 84571726 missense possibly damaging 0.86
R6218:Plekhh2 UTSW 17 84591564 missense probably benign 0.03
R6334:Plekhh2 UTSW 17 84566866 missense probably benign
R6345:Plekhh2 UTSW 17 84575787 missense probably benign 0.01
R6617:Plekhh2 UTSW 17 84566287 missense possibly damaging 0.65
R6755:Plekhh2 UTSW 17 84591585 missense probably damaging 1.00
R6864:Plekhh2 UTSW 17 84617999 missense probably benign 0.10
R7171:Plekhh2 UTSW 17 84521788 missense probably damaging 0.96
R7413:Plekhh2 UTSW 17 84566296 missense probably benign 0.03
R7585:Plekhh2 UTSW 17 84577180 missense probably benign 0.11
R7640:Plekhh2 UTSW 17 84610776 missense possibly damaging 0.50
R7733:Plekhh2 UTSW 17 84583524 nonsense probably null
R7877:Plekhh2 UTSW 17 84575006 missense probably benign
R8085:Plekhh2 UTSW 17 84597956 missense probably damaging 0.98
R8296:Plekhh2 UTSW 17 84600685 missense probably damaging 0.98
R8344:Plekhh2 UTSW 17 84571761 missense possibly damaging 0.64
R8438:Plekhh2 UTSW 17 84569951 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTTGGAGAAAGTGAGCCAG -3'
(R):5'- TGAAGCATCATTCTACATGTCTCC -3'

Sequencing Primer
(F):5'- GCCAGGCCAGAATGAGC -3'
(R):5'- GCATCATTCTACATGTCTCCAGAAG -3'
Posted On2020-07-13