Mutagenetix > Incidental Mutation

Incidental Mutation 'R8206:Arhgap26'

635940

Institutional Source

Beutler Lab

Gene Symbol

Arhgap26

Ensembl Gene

ENSMUSG00000036452

Gene Name

Rho GTPase activating protein 26

Synonyms

2610010G17Rik, 1810044B20Rik, 4933432P15Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8206 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

38601534-39376284 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 39306750 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 247 (S247*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097593] [ENSMUST00000137497] [ENSMUST00000141058] [ENSMUST00000151757] [ENSMUST00000155576]

AlphaFold

Q6ZQ82

Predicted Effect

probably null
Transcript: ENSMUST00000097593
AA Change: S629*

SMART Domains

Protein: ENSMUSP00000095200
Gene: ENSMUSG00000036452
AA Change: S629*

Domain	Start	End	E-Value	Type
Pfam:BAR_3	6	249	1.8e-90	PFAM
Pfam:IMD	26	231	2.8e-9	PFAM
PH	266	371	3.23e-8	SMART
RhoGAP	387	565	4.51e-65	SMART
low complexity region	584	600	N/A	INTRINSIC
low complexity region	617	652	N/A	INTRINSIC
low complexity region	657	701	N/A	INTRINSIC
SH3	759	814	5.11e-14	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000137497
AA Change: S78*

SMART Domains

Protein: ENSMUSP00000121197
Gene: ENSMUSG00000036452
AA Change: S78*

Domain	Start	End	E-Value	Type
PDB:1F7C\|A	1	32	7e-9	PDB
Blast:RhoGAP	16	65	2e-9	BLAST
low complexity region	66	101	N/A	INTRINSIC
SH3	116	171	5.11e-14	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000141058
AA Change: S63*

SMART Domains

Protein: ENSMUSP00000119865
Gene: ENSMUSG00000036452
AA Change: S63*

Domain	Start	End	E-Value	Type
Blast:RhoGAP	1	50	9e-10	BLAST
low complexity region	51	86	N/A	INTRINSIC
low complexity region	91	132	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000151757
AA Change: S63*

SMART Domains

Protein: ENSMUSP00000122448
Gene: ENSMUSG00000036452
AA Change: S63*

Domain	Start	End	E-Value	Type
Blast:RhoGAP	1	50	1e-9	BLAST
low complexity region	51	86	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000154551
AA Change: S247*

SMART Domains

Protein: ENSMUSP00000123145
Gene: ENSMUSG00000036452
AA Change: S247*

Domain	Start	End	E-Value	Type
RhoGAP	6	184	4.51e-65	SMART
low complexity region	203	219	N/A	INTRINSIC
low complexity region	236	271	N/A	INTRINSIC
low complexity region	276	317	N/A	INTRINSIC
SH3	333	388	5.11e-14	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000155576
AA Change: S629*

SMART Domains

Protein: ENSMUSP00000122371
Gene: ENSMUSG00000036452
AA Change: S629*

Domain	Start	End	E-Value	Type
Pfam:IMD	27	232	1.2e-8	PFAM
PH	266	371	3.23e-8	SMART
RhoGAP	387	565	4.51e-65	SMART
low complexity region	584	600	N/A	INTRINSIC
low complexity region	617	652	N/A	INTRINSIC
low complexity region	657	702	N/A	INTRINSIC
SH3	704	759	5.11e-14	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interaction of a cell with the extracellular matrix triggers integrin cell surface receptors to begin signaling cascades that regulate the organization of the actin-cytoskeleton. One of the proteins involved in these cascades is focal adhesion kinase. The protein encoded by this gene is a GTPase activating protein that binds to focal adhesion kinase and mediates the activity of the GTP binding proteins RhoA and Cdc42. Defects in this gene are a cause of juvenile myelomonocytic leukemia (JMML). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for a hypomorphic allele display reduced myofiber size, impaired myoblast fusion and abnormal muscle regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	A	T	9: 35,839,423	F34L	possibly damaging	Het
Ano4	A	G	10: 89,025,096	Y342H	probably damaging	Het
Aqp4	T	A	18: 15,393,659	D255V	possibly damaging	Het
Arid4a	A	G	12: 71,086,587	D1154G	probably damaging	Het
Atpaf2	A	G	11: 60,404,478	I182T	probably damaging	Het
Cacna1i	C	A	15: 80,389,815		probably null	Het
Ccdc38	A	G	10: 93,563,284	S205G	probably damaging	Het
Cep63	A	G	9: 102,621,271		probably benign	Het
Cyp24a1	T	C	2: 170,491,669	T255A	possibly damaging	Het
Dlg5	A	G	14: 24,160,268	S787P	possibly damaging	Het
Dnah6	A	T	6: 73,037,566	C3679*	probably null	Het
Dpy19l3	T	C	7: 35,729,730	Y95C	probably damaging	Het
Erc2	G	A	14: 28,303,015		probably null	Het
Ezh2	A	T	6: 47,532,900		probably null	Het
Fgfr1	A	G	8: 25,570,242	T463A	probably damaging	Het
Flvcr2	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Fsip2	T	C	2: 82,990,464	S5514P	possibly damaging	Het
Glrb	A	G	3: 80,851,066	Y347H	probably damaging	Het
Gm14325	C	A	2: 177,832,974	C105F	probably damaging	Het
Hgsnat	T	C	8: 25,954,637	T428A	probably damaging	Het
Ighv1-76	T	C	12: 115,848,314	M1V	probably null	Het
Inppl1	A	G	7: 101,823,576	I1207T	possibly damaging	Het
Kmt2c	T	A	5: 25,314,539	Q2191L	probably damaging	Het
Krt79	T	A	15: 101,940,270		probably null	Het
Mast4	G	A	13: 102,735,739	L2374F	probably damaging	Het
Mgam	A	G	6: 40,680,235	N951S	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naip6	A	T	13: 100,294,836	C1164*	probably null	Het
Nfatc2ip	G	T	7: 126,390,734	D189E	probably damaging	Het
Nrp1	A	G	8: 128,457,957	D361G	probably damaging	Het
Nrp2	T	C	1: 62,747,215	I293T	probably damaging	Het
Pde3a	T	C	6: 141,487,885	V831A	probably damaging	Het
Pirb	A	G	7: 3,712,906		probably null	Het
Plch1	G	T	3: 63,702,626		probably null	Het
Plekhh2	A	G	17: 84,590,849	T973A	possibly damaging	Het
Ppp1r35	T	A	5: 137,780,034	I97K	unknown	Het
Ppp1r3c	C	T	19: 36,733,446	G308E	probably benign	Het
Prss12	G	A	3: 123,464,962		probably null	Het
Rad51b	A	G	12: 79,314,941	D142G	probably damaging	Het
Slc13a3	C	T	2: 165,406,825	G553D	probably damaging	Het
Spata31d1d	A	C	13: 59,731,530	V64G	probably benign	Het
Srp68	G	A	11: 116,273,983	R42C	probably damaging	Het
Syne2	T	C	12: 76,015,591	V4229A	probably benign	Het
Tas2r144	G	A	6: 42,215,391	V22M	probably damaging	Het
Tcf7l1	A	G	6: 72,627,412	L583P	probably damaging	Het
Tdgf1	G	A	9: 110,944,284		probably benign	Het
Tdrd3	A	G	14: 87,511,778	D708G	probably benign	Het
Tns4	A	T	11: 99,085,801	L98Q	probably damaging	Het
Zfp677	T	A	17: 21,392,455		probably null	Het

Other mutations in Arhgap26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00706:Arhgap26	APN	18	39286551	missense	probably damaging	1.00
IGL01116:Arhgap26	APN	18	39111803	missense	probably damaging	0.97
IGL01409:Arhgap26	APN	18	39110451	splice site	probably benign
IGL02316:Arhgap26	APN	18	38642546	exon	noncoding transcript
IGL02418:Arhgap26	APN	18	39357567	intron	probably benign
IGL02588:Arhgap26	APN	18	38601617	unclassified	probably benign
IGL03241:Arhgap26	APN	18	39229917	missense	probably damaging	1.00
R0184:Arhgap26	UTSW	18	38617673	missense	unknown
R0244:Arhgap26	UTSW	18	39363131	missense	probably benign	0.05
R0347:Arhgap26	UTSW	18	38617744	missense	unknown
R1533:Arhgap26	UTSW	18	39371077	missense	probably benign	0.16
R1606:Arhgap26	UTSW	18	39296872	missense	probably damaging	1.00
R2066:Arhgap26	UTSW	18	39306728	missense	probably damaging	1.00
R2182:Arhgap26	UTSW	18	39357809	intron	probably benign
R2291:Arhgap26	UTSW	18	39357698	intron	probably benign
R3611:Arhgap26	UTSW	18	38933919	missense	probably benign
R3700:Arhgap26	UTSW	18	39120184	missense	probably damaging	0.99
R3887:Arhgap26	UTSW	18	39229966	critical splice donor site	probably null
R4621:Arhgap26	UTSW	18	38899841	intron	probably benign
R4877:Arhgap26	UTSW	18	39296929	splice site	probably null
R4910:Arhgap26	UTSW	18	38993637	splice site	probably benign
R4911:Arhgap26	UTSW	18	38993637	splice site	probably benign
R4954:Arhgap26	UTSW	18	39243641	missense	probably benign	0.00
R4967:Arhgap26	UTSW	18	39246840	missense	probably damaging	1.00
R5221:Arhgap26	UTSW	18	39110472	nonsense	probably null
R5232:Arhgap26	UTSW	18	38993476	start codon destroyed	probably null	0.97
R5297:Arhgap26	UTSW	18	39121888	missense	probably damaging	1.00
R5372:Arhgap26	UTSW	18	38642456	exon	noncoding transcript
R5570:Arhgap26	UTSW	18	39099618	missense	probably damaging	0.99
R5692:Arhgap26	UTSW	18	39121892	missense	probably damaging	1.00
R5752:Arhgap26	UTSW	18	39286672	missense	probably damaging	1.00
R5930:Arhgap26	UTSW	18	39150092	missense	probably damaging	0.96
R6131:Arhgap26	UTSW	18	39286585	nonsense	probably null
R6251:Arhgap26	UTSW	18	39357827	missense	probably null
R6481:Arhgap26	UTSW	18	39150057	missense	probably damaging	1.00
R6622:Arhgap26	UTSW	18	38899863	intron	probably benign
R6799:Arhgap26	UTSW	18	39099607	missense	probably damaging	1.00
R6878:Arhgap26	UTSW	18	39227412	missense	probably damaging	1.00
R6989:Arhgap26	UTSW	18	39099629	missense	probably damaging	1.00
R7248:Arhgap26	UTSW	18	39306854	critical splice donor site	probably null
R7936:Arhgap26	UTSW	18	39205287	missense	probably damaging	1.00
R7960:Arhgap26	UTSW	18	39229927	missense
R8103:Arhgap26	UTSW	18	39371124	missense
R8356:Arhgap26	UTSW	18	39111848	missense	possibly damaging	0.89
R8456:Arhgap26	UTSW	18	39111848	missense	possibly damaging	0.89
R8987:Arhgap26	UTSW	18	39357599	missense
R9025:Arhgap26	UTSW	18	39246845	missense
R9149:Arhgap26	UTSW	18	39111864	missense	possibly damaging	0.94
R9172:Arhgap26	UTSW	18	39245329	missense	probably damaging	1.00
R9191:Arhgap26	UTSW	18	39306840	missense
R9576:Arhgap26	UTSW	18	39120154	nonsense	probably null
X0013:Arhgap26	UTSW	18	39371112	missense	probably damaging	1.00
X0025:Arhgap26	UTSW	18	39150105	missense	probably damaging	1.00
Z1088:Arhgap26	UTSW	18	39357671	splice site	probably benign

Predicted Primers

PCR Primer
(F):5'- AATGCTCTTCCTCGCTGAGC -3'
(R):5'- AGGTTAAGCCGGAGAAATTCTG -3'

Sequencing Primer
(F):5'- GTCAAGTTGGCACTGAACTCC -3'
(R):5'- AATTCTGGTAGGACAGATGCTG -3'

Posted On

2020-07-13