Incidental Mutation 'R8207:Farp2'
ID635942
Institutional Source Beutler Lab
Gene Symbol Farp2
Ensembl Gene ENSMUSG00000034066
Gene NameFERM, RhoGEF and pleckstrin domain protein 2
SynonymsFir, D030026M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8207 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location93512079-93621976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93621243 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 1024 (R1024G)
Ref Sequence ENSEMBL: ENSMUSP00000112725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027498] [ENSMUST00000120301] [ENSMUST00000133769]
PDB Structure
Crystal strucure of the DH domain of FARP2 [X-RAY DIFFRACTION]
Crystal strucure of the DH-PH-PH domain of FARP2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027498
SMART Domains Protein: ENSMUSP00000027498
Gene: ENSMUSG00000026277

DomainStartEndE-ValueType
S_TKc 20 270 2.92e-98 SMART
low complexity region 292 314 N/A INTRINSIC
PDB:3W8H|B 355 426 8e-43 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000120301
AA Change: R1024G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112725
Gene: ENSMUSG00000034066
AA Change: R1024G

DomainStartEndE-ValueType
B41 40 234 1.48e-66 SMART
FERM_C 238 328 3.29e-35 SMART
FA 332 378 1.13e-15 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
RhoGEF 542 728 1.57e-56 SMART
PH 759 857 1.45e-19 SMART
low complexity region 879 890 N/A INTRINSIC
PH 931 1029 2.62e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133769
SMART Domains Protein: ENSMUSP00000117765
Gene: ENSMUSG00000026277

DomainStartEndE-ValueType
Pfam:Pkinase 20 233 1.7e-63 PFAM
Pfam:Pkinase_Tyr 20 233 2.1e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit slight increase in bone volumetrics and reduced osteoclast differentiation from BMDMs cultured with M-CSF and RANKL [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T A 9: 92,351,008 F61L probably benign Het
Aen G A 7: 78,902,743 M150I possibly damaging Het
Arhgef11 A G 3: 87,698,775 N279S possibly damaging Het
Arid3a T C 10: 79,950,926 probably null Het
Casp8ap2 A G 4: 32,646,446 T1840A possibly damaging Het
Ccdc14 T A 16: 34,705,043 N235K possibly damaging Het
Cdh7 T C 1: 109,994,346 V56A probably damaging Het
Clec16a A G 16: 10,627,448 N518S probably benign Het
Clec16a G A 16: 10,694,710 R837H probably damaging Het
Cog7 T C 7: 121,977,292 D137G possibly damaging Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Efcab8 C G 2: 153,789,225 L192V probably damaging Het
Fmo1 T A 1: 162,850,107 T147S probably benign Het
Galnt13 A C 2: 54,880,110 I305L probably benign Het
Guca2a A G 4: 119,637,754 N2D unknown Het
Iqcd C T 5: 120,602,449 R282W probably damaging Het
Lamc1 A C 1: 153,250,522 C475G probably damaging Het
Map3k5 AAAAGAAAAAGA AA 10: 20,110,866 probably null Het
Med13 A T 11: 86,303,549 D789E probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mn1 A G 5: 111,421,785 Y1207C probably damaging Het
Mroh2b A G 15: 4,938,410 D977G possibly damaging Het
Mrpl53 A T 6: 83,109,188 N26I probably damaging Het
Ogdh T G 11: 6,349,329 F743V probably benign Het
Olfr1424 A T 19: 12,058,858 M298K possibly damaging Het
Olfr732 C T 14: 50,281,579 V225I probably benign Het
Olfr788 A G 10: 129,473,084 T131A probably benign Het
Pmvk A G 3: 89,468,592 E174G probably benign Het
Pou6f2 T C 13: 18,239,573 N206D Het
Riok1 T A 13: 38,052,320 H347Q probably damaging Het
Ryr1 A G 7: 29,090,225 L1488P probably damaging Het
Shkbp1 A G 7: 27,352,684 V158A probably benign Het
Slc9c1 A G 16: 45,539,713 I43M possibly damaging Het
Slmo1 A T 18: 67,472,948 S42C probably benign Het
Smarca2 A G 19: 26,676,680 N755S possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfb2m G A 1: 179,546,103 P10L probably benign Het
Trim30c T C 7: 104,383,496 M252V probably benign Het
Ttll1 A G 15: 83,500,078 L116P probably damaging Het
Tubd1 C T 11: 86,549,422 H91Y possibly damaging Het
Vgll4 A G 6: 114,862,825 S175P probably damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Vmn2r80 C T 10: 79,194,316 Q659* probably null Het
Zfp382 A G 7: 30,134,415 D497G possibly damaging Het
Zfp41 A G 15: 75,618,535 E112G probably damaging Het
Zfyve26 A G 12: 79,260,831 S1754P probably damaging Het
Other mutations in Farp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Farp2 APN 1 93603381 missense probably benign 0.00
IGL00953:Farp2 APN 1 93561174 missense possibly damaging 0.92
IGL00961:Farp2 APN 1 93621313 missense possibly damaging 0.81
IGL00970:Farp2 APN 1 93560327 missense probably benign 0.00
IGL01377:Farp2 APN 1 93603459 missense possibly damaging 0.74
IGL01408:Farp2 APN 1 93618980 missense probably benign 0.19
IGL01919:Farp2 APN 1 93576433 missense probably damaging 1.00
IGL01985:Farp2 APN 1 93607602 missense probably damaging 1.00
IGL02375:Farp2 APN 1 93576463 missense probably damaging 1.00
IGL02392:Farp2 APN 1 93577650 missense probably damaging 1.00
IGL02815:Farp2 APN 1 93560285 missense probably damaging 1.00
IGL03003:Farp2 APN 1 93567418 missense probably damaging 1.00
IGL03074:Farp2 APN 1 93560327 missense probably benign 0.00
IGL03223:Farp2 APN 1 93617602 nonsense probably null
IGL03379:Farp2 APN 1 93607438 missense probably benign 0.08
IGL02802:Farp2 UTSW 1 93528610 missense probably damaging 1.00
PIT4468001:Farp2 UTSW 1 93528777 nonsense probably null
PIT4494001:Farp2 UTSW 1 93617594 missense probably damaging 1.00
R0207:Farp2 UTSW 1 93569087 missense probably damaging 0.96
R0521:Farp2 UTSW 1 93576821 critical splice acceptor site probably null
R0594:Farp2 UTSW 1 93576500 missense probably damaging 1.00
R1386:Farp2 UTSW 1 93620151 splice site probably null
R1522:Farp2 UTSW 1 93618553 missense possibly damaging 0.79
R1589:Farp2 UTSW 1 93579860 missense probably damaging 1.00
R1651:Farp2 UTSW 1 93603469 critical splice donor site probably null
R1695:Farp2 UTSW 1 93560325 missense probably damaging 0.97
R1833:Farp2 UTSW 1 93576364 splice site probably benign
R1915:Farp2 UTSW 1 93528702 missense probably benign 0.16
R2241:Farp2 UTSW 1 93579903 missense probably benign 0.31
R4505:Farp2 UTSW 1 93619010 missense probably damaging 1.00
R4518:Farp2 UTSW 1 93620641 missense probably benign 0.04
R4551:Farp2 UTSW 1 93618592 missense possibly damaging 0.92
R4723:Farp2 UTSW 1 93580899 missense probably benign 0.07
R4821:Farp2 UTSW 1 93574470 splice site probably null
R4861:Farp2 UTSW 1 93605419 missense probably damaging 1.00
R4861:Farp2 UTSW 1 93605419 missense probably damaging 1.00
R5221:Farp2 UTSW 1 93576418 missense probably damaging 0.99
R5625:Farp2 UTSW 1 93528748 missense probably damaging 1.00
R5663:Farp2 UTSW 1 93570013 missense probably damaging 1.00
R5935:Farp2 UTSW 1 93620645 critical splice donor site probably null
R6593:Farp2 UTSW 1 93569940 missense possibly damaging 0.48
R6853:Farp2 UTSW 1 93570016 missense probably damaging 1.00
R7001:Farp2 UTSW 1 93620184 missense possibly damaging 0.94
R7001:Farp2 UTSW 1 93620230 missense possibly damaging 0.94
R7133:Farp2 UTSW 1 93621234 missense probably damaging 1.00
R7134:Farp2 UTSW 1 93603459 missense probably benign 0.04
R7184:Farp2 UTSW 1 93603415 missense probably damaging 1.00
R7219:Farp2 UTSW 1 93560318 missense probably damaging 0.97
R7234:Farp2 UTSW 1 93580119 missense possibly damaging 0.94
R7426:Farp2 UTSW 1 93621228 missense possibly damaging 0.55
R7477:Farp2 UTSW 1 93581028 splice site probably null
R7503:Farp2 UTSW 1 93567497 missense probably benign 0.03
R7921:Farp2 UTSW 1 93567515 critical splice donor site probably null
R7939:Farp2 UTSW 1 93560261 missense probably damaging 1.00
R7985:Farp2 UTSW 1 93576524 missense probably damaging 1.00
R8162:Farp2 UTSW 1 93620603 missense probably damaging 1.00
R8292:Farp2 UTSW 1 93528628 missense probably damaging 1.00
Z1176:Farp2 UTSW 1 93580136 missense probably benign
Z1176:Farp2 UTSW 1 93580461 missense probably benign
Z1176:Farp2 UTSW 1 93580467 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGCCTTGTTTTAGGAGACAG -3'
(R):5'- AGTGCCTGGGATGATGCTTAC -3'

Sequencing Primer
(F):5'- ACCTCCTCAGTGCTGGATTAGG -3'
(R):5'- GATGATGCTTACAGTCCCTGCAAG -3'
Posted On2020-07-13