Incidental Mutation 'R8207:Tfb2m'
ID635946
Institutional Source Beutler Lab
Gene Symbol Tfb2m
Ensembl Gene ENSMUSG00000026492
Gene Nametranscription factor B2, mitochondrial
SynonymsHkp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R8207 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location179528055-179546267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 179546103 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 10 (P10L)
Ref Sequence ENSEMBL: ENSMUSP00000027769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027769] [ENSMUST00000040706]
Predicted Effect probably benign
Transcript: ENSMUST00000027769
AA Change: P10L

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027769
Gene: ENSMUSG00000026492
AA Change: P10L

DomainStartEndE-ValueType
Pfam:RrnaAD 79 377 6.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040706
SMART Domains Protein: ENSMUSP00000048205
Gene: ENSMUSG00000038949

DomainStartEndE-ValueType
low complexity region 109 126 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
Pfam:Consortin_C 598 709 3.4e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T A 9: 92,351,008 F61L probably benign Het
Aen G A 7: 78,902,743 M150I possibly damaging Het
Arhgef11 A G 3: 87,698,775 N279S possibly damaging Het
Arid3a T C 10: 79,950,926 probably null Het
Casp8ap2 A G 4: 32,646,446 T1840A possibly damaging Het
Ccdc14 T A 16: 34,705,043 N235K possibly damaging Het
Cdh7 T C 1: 109,994,346 V56A probably damaging Het
Clec16a A G 16: 10,627,448 N518S probably benign Het
Clec16a G A 16: 10,694,710 R837H probably damaging Het
Cog7 T C 7: 121,977,292 D137G possibly damaging Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Efcab8 C G 2: 153,789,225 L192V probably damaging Het
Farp2 A G 1: 93,621,243 R1024G probably benign Het
Fmo1 T A 1: 162,850,107 T147S probably benign Het
Galnt13 A C 2: 54,880,110 I305L probably benign Het
Guca2a A G 4: 119,637,754 N2D unknown Het
Iqcd C T 5: 120,602,449 R282W probably damaging Het
Lamc1 A C 1: 153,250,522 C475G probably damaging Het
Map3k5 AAAAGAAAAAGA AA 10: 20,110,866 probably null Het
Med13 A T 11: 86,303,549 D789E probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mn1 A G 5: 111,421,785 Y1207C probably damaging Het
Mroh2b A G 15: 4,938,410 D977G possibly damaging Het
Mrpl53 A T 6: 83,109,188 N26I probably damaging Het
Ogdh T G 11: 6,349,329 F743V probably benign Het
Olfr1424 A T 19: 12,058,858 M298K possibly damaging Het
Olfr732 C T 14: 50,281,579 V225I probably benign Het
Olfr788 A G 10: 129,473,084 T131A probably benign Het
Pmvk A G 3: 89,468,592 E174G probably benign Het
Pou6f2 T C 13: 18,239,573 N206D Het
Riok1 T A 13: 38,052,320 H347Q probably damaging Het
Ryr1 A G 7: 29,090,225 L1488P probably damaging Het
Shkbp1 A G 7: 27,352,684 V158A probably benign Het
Slc9c1 A G 16: 45,539,713 I43M possibly damaging Het
Slmo1 A T 18: 67,472,948 S42C probably benign Het
Smarca2 A G 19: 26,676,680 N755S possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Trim30c T C 7: 104,383,496 M252V probably benign Het
Ttll1 A G 15: 83,500,078 L116P probably damaging Het
Tubd1 C T 11: 86,549,422 H91Y possibly damaging Het
Vgll4 A G 6: 114,862,825 S175P probably damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Vmn2r80 C T 10: 79,194,316 Q659* probably null Het
Zfp382 A G 7: 30,134,415 D497G possibly damaging Het
Zfp41 A G 15: 75,618,535 E112G probably damaging Het
Zfyve26 A G 12: 79,260,831 S1754P probably damaging Het
Other mutations in Tfb2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01372:Tfb2m APN 1 179542313 missense probably damaging 1.00
IGL01415:Tfb2m APN 1 179532130 splice site probably benign
IGL01538:Tfb2m APN 1 179537844 missense possibly damaging 0.87
IGL01939:Tfb2m APN 1 179537697 critical splice donor site probably null
IGL02434:Tfb2m APN 1 179532135 splice site probably benign
IGL02795:Tfb2m APN 1 179545959 missense possibly damaging 0.88
R0267:Tfb2m UTSW 1 179533638 missense probably benign 0.10
R0504:Tfb2m UTSW 1 179545831 missense probably damaging 1.00
R0514:Tfb2m UTSW 1 179531304 missense probably benign 0.05
R0518:Tfb2m UTSW 1 179537824 missense possibly damaging 0.47
R0762:Tfb2m UTSW 1 179545833 missense probably damaging 1.00
R1542:Tfb2m UTSW 1 179537861 splice site probably null
R1697:Tfb2m UTSW 1 179544899 missense probably null 1.00
R2421:Tfb2m UTSW 1 179533666 missense possibly damaging 0.56
R5384:Tfb2m UTSW 1 179545872 splice site probably null
R5583:Tfb2m UTSW 1 179545881 missense probably benign 0.16
R6522:Tfb2m UTSW 1 179546046 missense probably benign 0.45
R7425:Tfb2m UTSW 1 179537704 missense probably benign 0.08
R7480:Tfb2m UTSW 1 179529182 missense probably benign
R7846:Tfb2m UTSW 1 179531361 missense probably damaging 1.00
R8286:Tfb2m UTSW 1 179529205 missense probably damaging 1.00
R8337:Tfb2m UTSW 1 179542349 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCGATTCCTGGATGTCCACG -3'
(R):5'- TAGAGTTCCAGCACGGACAC -3'

Sequencing Primer
(F):5'- GGGGACGACTCCTCCAAATCAG -3'
(R):5'- CAAAGGACTGAGGCTAGGTCGTTC -3'
Posted On2020-07-13