Incidental Mutation 'R8207:Pmvk'
List |< first << previous [record 29 of 47] next >> last >|
ID635950
Institutional Source Beutler Lab
Gene Symbol Pmvk
Ensembl Gene ENSMUSG00000027952
Gene Namephosphomevalonate kinase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R8207 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location89454541-89469013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89468592 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 174 (E174G)
Ref Sequence ENSEMBL: ENSMUSP00000029564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029564] [ENSMUST00000107410] [ENSMUST00000184515] [ENSMUST00000198440]
Predicted Effect probably benign
Transcript: ENSMUST00000029564
AA Change: E174G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029564
Gene: ENSMUSG00000027952
AA Change: E174G

DomainStartEndE-ValueType
Pfam:P-mevalo_kinase 14 124 1.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107410
SMART Domains Protein: ENSMUSP00000103033
Gene: ENSMUSG00000027952

DomainStartEndE-ValueType
Pfam:P-mevalo_kinase 14 129 9.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184515
AA Change: E153G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000139116
Gene: ENSMUSG00000027952
AA Change: E153G

DomainStartEndE-ValueType
Pfam:P-mevalo_kinase 5 108 3.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198440
AA Change: E99G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000143154
Gene: ENSMUSG00000027952
AA Change: E99G

DomainStartEndE-ValueType
Pfam:P-mevalo_kinase 1 54 5.6e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peroxisomal enzyme that is a member of the galactokinase, homoserine kinase, mevalonate kinase, and phosphomevalonate kinase (GHMP) family of ATP-dependent enzymes. The encoded protein catalyzes the conversion of mevalonate 5-phosphate to mevalonate 5-diphosphate, which is the fifth step in the mevalonate pathway of isoprenoid biosynthesis. Mutations in this gene are linked to certain types of porokeratosis including disseminated superficial porokeratosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T A 9: 92,351,008 F61L probably benign Het
Aen G A 7: 78,902,743 M150I possibly damaging Het
Arhgef11 A G 3: 87,698,775 N279S possibly damaging Het
Arid3a T C 10: 79,950,926 probably null Het
Casp8ap2 A G 4: 32,646,446 T1840A possibly damaging Het
Ccdc14 T A 16: 34,705,043 N235K possibly damaging Het
Cdh7 T C 1: 109,994,346 V56A probably damaging Het
Clec16a A G 16: 10,627,448 N518S probably benign Het
Clec16a G A 16: 10,694,710 R837H probably damaging Het
Cog7 T C 7: 121,977,292 D137G possibly damaging Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Efcab8 C G 2: 153,789,225 L192V probably damaging Het
Farp2 A G 1: 93,621,243 R1024G probably benign Het
Fmo1 T A 1: 162,850,107 T147S probably benign Het
Fryl A C 5: 73,100,500 probably null Het
Galnt13 A C 2: 54,880,110 I305L probably benign Het
Guca2a A G 4: 119,637,754 N2D unknown Het
Iqcd C T 5: 120,602,449 R282W probably damaging Het
Lamc1 A C 1: 153,250,522 C475G probably damaging Het
Map3k5 AAAAGAAAAAGA AA 10: 20,110,866 probably null Het
Med13 A T 11: 86,303,549 D789E probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mn1 A G 5: 111,421,785 Y1207C probably damaging Het
Mroh2b A G 15: 4,938,410 D977G possibly damaging Het
Mrpl53 A T 6: 83,109,188 N26I probably damaging Het
Nell1 A T 7: 50,220,012 probably null Het
Ogdh T G 11: 6,349,329 F743V probably benign Het
Olfr1424 A T 19: 12,058,858 M298K possibly damaging Het
Olfr732 C T 14: 50,281,579 V225I probably benign Het
Olfr788 A G 10: 129,473,084 T131A probably benign Het
Pou6f2 T C 13: 18,239,573 N206D Het
Riok1 T A 13: 38,052,320 H347Q probably damaging Het
Ryr1 A G 7: 29,090,225 L1488P probably damaging Het
Shkbp1 A G 7: 27,352,684 V158A probably benign Het
Slc9c1 A G 16: 45,539,713 I43M possibly damaging Het
Slmo1 A T 18: 67,472,948 S42C probably benign Het
Smarca2 A G 19: 26,676,680 N755S possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfb2m G A 1: 179,546,103 P10L probably benign Het
Trim30c T C 7: 104,383,496 M252V probably benign Het
Ttll1 A G 15: 83,500,078 L116P probably damaging Het
Tubd1 C T 11: 86,549,422 H91Y possibly damaging Het
Vgll4 A G 6: 114,862,825 S175P probably damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Vmn2r80 C T 10: 79,194,316 Q659* probably null Het
Zfp382 A G 7: 30,134,415 D497G possibly damaging Het
Zfp41 A G 15: 75,618,535 E112G probably damaging Het
Zfyve26 A G 12: 79,260,831 S1754P probably damaging Het
Other mutations in Pmvk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Pmvk APN 3 89467583 missense probably damaging 1.00
R2090:Pmvk UTSW 3 89461882 missense possibly damaging 0.53
R3034:Pmvk UTSW 3 89468517 missense probably damaging 0.99
R5337:Pmvk UTSW 3 89468571 missense probably benign 0.36
R5469:Pmvk UTSW 3 89467682 critical splice donor site probably null
R5842:Pmvk UTSW 3 89467620 missense probably damaging 1.00
R5877:Pmvk UTSW 3 89464369 missense probably benign 0.25
R7657:Pmvk UTSW 3 89468851 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GTGATTTCATCAGGGGCTGC -3'
(R):5'- CACTACTCACGAGCATCCTG -3'

Sequencing Primer
(F):5'- GCTGCCTGGGAGCTCAG -3'
(R):5'- TCACGAGCATCCTGCCCAG -3'
Posted On2020-07-13