Incidental Mutation 'R8207:Iqcd'
List |< first << previous [record 17 of 47] next >> last >|
ID635954
Institutional Source Beutler Lab
Gene Symbol Iqcd
Ensembl Gene ENSMUSG00000029601
Gene NameIQ motif containing D
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R8207 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location120589016-120607118 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120602449 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 282 (R282W)
Ref Sequence ENSEMBL: ENSMUSP00000091955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069259] [ENSMUST00000094391] [ENSMUST00000111884] [ENSMUST00000156356]
Predicted Effect probably damaging
Transcript: ENSMUST00000069259
AA Change: R282W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069167
Gene: ENSMUSG00000029601
AA Change: R282W

DomainStartEndE-ValueType
coiled coil region 97 137 N/A INTRINSIC
coiled coil region 209 257 N/A INTRINSIC
coiled coil region 298 348 N/A INTRINSIC
IQ 363 385 5.53e-4 SMART
low complexity region 387 425 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094391
AA Change: R282W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091955
Gene: ENSMUSG00000029601
AA Change: R282W

DomainStartEndE-ValueType
coiled coil region 97 137 N/A INTRINSIC
coiled coil region 209 257 N/A INTRINSIC
coiled coil region 331 381 N/A INTRINSIC
IQ 396 418 5.53e-4 SMART
low complexity region 420 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111884
Predicted Effect probably benign
Transcript: ENSMUST00000156356
SMART Domains Protein: ENSMUSP00000122910
Gene: ENSMUSG00000029600

DomainStartEndE-ValueType
low complexity region 81 91 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T A 9: 92,351,008 F61L probably benign Het
Aen G A 7: 78,902,743 M150I possibly damaging Het
Arhgef11 A G 3: 87,698,775 N279S possibly damaging Het
Arid3a T C 10: 79,950,926 probably null Het
Casp8ap2 A G 4: 32,646,446 T1840A possibly damaging Het
Ccdc14 T A 16: 34,705,043 N235K possibly damaging Het
Cdh7 T C 1: 109,994,346 V56A probably damaging Het
Clec16a A G 16: 10,627,448 N518S probably benign Het
Clec16a G A 16: 10,694,710 R837H probably damaging Het
Cog7 T C 7: 121,977,292 D137G possibly damaging Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Efcab8 C G 2: 153,789,225 L192V probably damaging Het
Farp2 A G 1: 93,621,243 R1024G probably benign Het
Fmo1 T A 1: 162,850,107 T147S probably benign Het
Fryl A C 5: 73,100,500 probably null Het
Galnt13 A C 2: 54,880,110 I305L probably benign Het
Guca2a A G 4: 119,637,754 N2D unknown Het
Lamc1 A C 1: 153,250,522 C475G probably damaging Het
Map3k5 AAAAGAAAAAGA AA 10: 20,110,866 probably null Het
Med13 A T 11: 86,303,549 D789E probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mn1 A G 5: 111,421,785 Y1207C probably damaging Het
Mroh2b A G 15: 4,938,410 D977G possibly damaging Het
Mrpl53 A T 6: 83,109,188 N26I probably damaging Het
Nell1 A T 7: 50,220,012 probably null Het
Ogdh T G 11: 6,349,329 F743V probably benign Het
Olfr1424 A T 19: 12,058,858 M298K possibly damaging Het
Olfr732 C T 14: 50,281,579 V225I probably benign Het
Olfr788 A G 10: 129,473,084 T131A probably benign Het
Pmvk A G 3: 89,468,592 E174G probably benign Het
Pou6f2 T C 13: 18,239,573 N206D Het
Riok1 T A 13: 38,052,320 H347Q probably damaging Het
Ryr1 A G 7: 29,090,225 L1488P probably damaging Het
Shkbp1 A G 7: 27,352,684 V158A probably benign Het
Slc9c1 A G 16: 45,539,713 I43M possibly damaging Het
Slmo1 A T 18: 67,472,948 S42C probably benign Het
Smarca2 A G 19: 26,676,680 N755S possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfb2m G A 1: 179,546,103 P10L probably benign Het
Trim30c T C 7: 104,383,496 M252V probably benign Het
Ttll1 A G 15: 83,500,078 L116P probably damaging Het
Tubd1 C T 11: 86,549,422 H91Y possibly damaging Het
Vgll4 A G 6: 114,862,825 S175P probably damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Vmn2r80 C T 10: 79,194,316 Q659* probably null Het
Zfp382 A G 7: 30,134,415 D497G possibly damaging Het
Zfp41 A G 15: 75,618,535 E112G probably damaging Het
Zfyve26 A G 12: 79,260,831 S1754P probably damaging Het
Other mutations in Iqcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Iqcd APN 5 120600489 missense probably benign 0.00
R1420:Iqcd UTSW 5 120600795 missense probably damaging 1.00
R1574:Iqcd UTSW 5 120600235 missense probably damaging 0.98
R1574:Iqcd UTSW 5 120600235 missense probably damaging 0.98
R4038:Iqcd UTSW 5 120602522 missense probably damaging 0.97
R4178:Iqcd UTSW 5 120602411 missense probably damaging 1.00
R4405:Iqcd UTSW 5 120602420 missense probably damaging 1.00
R5326:Iqcd UTSW 5 120602375 missense probably damaging 1.00
R5364:Iqcd UTSW 5 120600267 missense probably damaging 1.00
R5656:Iqcd UTSW 5 120605126 splice site probably null
R5691:Iqcd UTSW 5 120602506 nonsense probably null
R5711:Iqcd UTSW 5 120602506 nonsense probably null
R6387:Iqcd UTSW 5 120606855 missense probably benign 0.28
R6556:Iqcd UTSW 5 120602378 missense probably damaging 0.99
R6634:Iqcd UTSW 5 120600491 missense probably benign 0.14
R7067:Iqcd UTSW 5 120605147 missense probably damaging 1.00
R7672:Iqcd UTSW 5 120606816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTGGCTATTAAATAGGGCC -3'
(R):5'- GATTTGACCTCCTTGACCCAAC -3'

Sequencing Primer
(F):5'- GGCTATTAAATAGGGCCCTGTCC -3'
(R):5'- AGGAGATCCCACCTATCTTGG -3'
Posted On2020-07-13