Incidental Mutation 'R8207:Mrpl53'
ID 635955
Institutional Source Beutler Lab
Gene Symbol Mrpl53
Ensembl Gene ENSMUSG00000030037
Gene Name mitochondrial ribosomal protein L53
Synonyms 1110007K17Rik
MMRRC Submission 067630-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.828) question?
Stock # R8207 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 83086089-83086913 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 83086169 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 26 (N26I)
Ref Sequence ENSEMBL: ENSMUSP00000109571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101253] [ENSMUST00000101254] [ENSMUST00000113938]
AlphaFold Q9D1H8
Predicted Effect probably benign
Transcript: ENSMUST00000101253
SMART Domains Protein: ENSMUSP00000098811
Gene: ENSMUSG00000079511

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
low complexity region 70 91 N/A INTRINSIC
low complexity region 102 118 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 238 263 N/A INTRINSIC
Pfam:CCDC142 286 714 1.6e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101254
SMART Domains Protein: ENSMUSP00000098812
Gene: ENSMUSG00000107499

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
low complexity region 70 91 N/A INTRINSIC
low complexity region 102 118 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 238 263 N/A INTRINSIC
Pfam:CCDC142 279 714 8.5e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113938
AA Change: N26I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109571
Gene: ENSMUSG00000030037
AA Change: N26I

DomainStartEndE-ValueType
Pfam:MRP_L53 20 71 2.7e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. A pseudogene corresponding to this gene is found on chromosome 1p. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aen G A 7: 78,552,491 (GRCm39) M150I possibly damaging Het
Arhgef11 A G 3: 87,606,082 (GRCm39) N279S possibly damaging Het
Arid3a T C 10: 79,786,760 (GRCm39) probably null Het
Casp8ap2 A G 4: 32,646,446 (GRCm39) T1840A possibly damaging Het
Ccdc14 T A 16: 34,525,413 (GRCm39) N235K possibly damaging Het
Cdh20 T C 1: 109,922,076 (GRCm39) V56A probably damaging Het
Clec16a G A 16: 10,512,574 (GRCm39) R837H probably damaging Het
Clec16a A G 16: 10,445,312 (GRCm39) N518S probably benign Het
Cog7 T C 7: 121,576,515 (GRCm39) D137G possibly damaging Het
Cpt1b T C 15: 89,303,018 (GRCm39) T649A probably damaging Het
Efcab8 C G 2: 153,631,145 (GRCm39) L192V probably damaging Het
Farp2 A G 1: 93,548,965 (GRCm39) R1024G probably benign Het
Flvcr2 GTAGTGTATA GTA 12: 85,849,922 (GRCm39) probably null Het
Fmo1 T A 1: 162,677,676 (GRCm39) T147S probably benign Het
Fryl A C 5: 73,257,843 (GRCm39) probably null Het
Galnt13 A C 2: 54,770,122 (GRCm39) I305L probably benign Het
Guca2a A G 4: 119,494,951 (GRCm39) N2D unknown Het
Iqcd C T 5: 120,740,514 (GRCm39) R282W probably damaging Het
Lamc1 A C 1: 153,126,268 (GRCm39) C475G probably damaging Het
Map3k5 AAAAGAAAAAGA AA 10: 19,986,612 (GRCm39) probably null Het
Med13 A T 11: 86,194,375 (GRCm39) D789E probably damaging Het
Mn1 A G 5: 111,569,651 (GRCm39) Y1207C probably damaging Het
Mroh2b A G 15: 4,967,892 (GRCm39) D977G possibly damaging Het
Nell1 A T 7: 49,869,760 (GRCm39) probably null Het
Ogdh T G 11: 6,299,329 (GRCm39) F743V probably benign Het
Or4d10b A T 19: 12,036,222 (GRCm39) M298K possibly damaging Het
Or4n4 C T 14: 50,519,036 (GRCm39) V225I probably benign Het
Or6c3 A G 10: 129,308,953 (GRCm39) T131A probably benign Het
Plscr1l1 T A 9: 92,233,061 (GRCm39) F61L probably benign Het
Pmvk A G 3: 89,375,899 (GRCm39) E174G probably benign Het
Pou6f2 T C 13: 18,414,158 (GRCm39) N206D Het
Prelid3a A T 18: 67,606,018 (GRCm39) S42C probably benign Het
Riok1 T A 13: 38,236,296 (GRCm39) H347Q probably damaging Het
Ryr1 A G 7: 28,789,650 (GRCm39) L1488P probably damaging Het
Shkbp1 A G 7: 27,052,109 (GRCm39) V158A probably benign Het
Slc9c1 A G 16: 45,360,076 (GRCm39) I43M possibly damaging Het
Smarca2 A G 19: 26,654,080 (GRCm39) N755S possibly damaging Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Tfb2m G A 1: 179,373,668 (GRCm39) P10L probably benign Het
Trim30c T C 7: 104,032,703 (GRCm39) M252V probably benign Het
Ttll1 A G 15: 83,384,279 (GRCm39) L116P probably damaging Het
Tubd1 C T 11: 86,440,248 (GRCm39) H91Y possibly damaging Het
Vgll4 A G 6: 114,839,786 (GRCm39) S175P probably damaging Het
Vmn1r79 A G 7: 11,910,415 (GRCm39) Y99C possibly damaging Het
Vmn2r80 C T 10: 79,030,150 (GRCm39) Q659* probably null Het
Zfp382 A G 7: 29,833,840 (GRCm39) D497G possibly damaging Het
Zfp41 A G 15: 75,490,384 (GRCm39) E112G probably damaging Het
Zfyve26 A G 12: 79,307,605 (GRCm39) S1754P probably damaging Het
Other mutations in Mrpl53
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0148:Mrpl53 UTSW 6 83,086,518 (GRCm39) missense probably damaging 1.00
R0362:Mrpl53 UTSW 6 83,086,526 (GRCm39) missense probably damaging 1.00
R0639:Mrpl53 UTSW 6 83,086,392 (GRCm39) missense probably damaging 0.98
R5109:Mrpl53 UTSW 6 83,086,541 (GRCm39) missense probably damaging 0.98
R5174:Mrpl53 UTSW 6 83,086,638 (GRCm39) missense possibly damaging 0.49
R8081:Mrpl53 UTSW 6 83,086,159 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAACACTGCTAATGGCTG -3'
(R):5'- TCACAGAGCAGTTGAGGTTG -3'

Sequencing Primer
(F):5'- CACTGCTAATGGCTGAAGTATTCGC -3'
(R):5'- GGTGGCGCGGACTTTCTC -3'
Posted On 2020-07-13