Incidental Mutation 'R8207:Shkbp1'
List |< first << previous [record 33 of 47] next >> last >|
ID635958
Institutional Source Beutler Lab
Gene Symbol Shkbp1
Ensembl Gene ENSMUSG00000089832
Gene NameSh3kbp1 binding protein 1
SynonymsB930062H15Rik, SB1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8207 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location27342133-27356019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27352684 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 158 (V158A)
Ref Sequence ENSEMBL: ENSMUSP00000003857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003857] [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]
Predicted Effect probably benign
Transcript: ENSMUST00000003857
AA Change: V158A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000003857
Gene: ENSMUSG00000089832
AA Change: V158A

DomainStartEndE-ValueType
BTB 19 119 1.65e-16 SMART
low complexity region 183 194 N/A INTRINSIC
Blast:WD40 196 271 1e-21 BLAST
WD40 277 313 1.9e2 SMART
WD40 419 457 3.45e-1 SMART
WD40 527 577 3.68e1 SMART
low complexity region 612 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000011895
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108362
SMART Domains Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108363
SMART Domains Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108364
SMART Domains Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126587
Predicted Effect probably benign
Transcript: ENSMUST00000172269
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T A 9: 92,351,008 F61L probably benign Het
Aen G A 7: 78,902,743 M150I possibly damaging Het
Arhgef11 A G 3: 87,698,775 N279S possibly damaging Het
Arid3a T C 10: 79,950,926 probably null Het
Casp8ap2 A G 4: 32,646,446 T1840A possibly damaging Het
Ccdc14 T A 16: 34,705,043 N235K possibly damaging Het
Cdh7 T C 1: 109,994,346 V56A probably damaging Het
Clec16a G A 16: 10,694,710 R837H probably damaging Het
Clec16a A G 16: 10,627,448 N518S probably benign Het
Cog7 T C 7: 121,977,292 D137G possibly damaging Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Efcab8 C G 2: 153,789,225 L192V probably damaging Het
Farp2 A G 1: 93,621,243 R1024G probably benign Het
Fmo1 T A 1: 162,850,107 T147S probably benign Het
Fryl A C 5: 73,100,500 probably null Het
Galnt13 A C 2: 54,880,110 I305L probably benign Het
Guca2a A G 4: 119,637,754 N2D unknown Het
Iqcd C T 5: 120,602,449 R282W probably damaging Het
Lamc1 A C 1: 153,250,522 C475G probably damaging Het
Map3k5 AAAAGAAAAAGA AA 10: 20,110,866 probably null Het
Med13 A T 11: 86,303,549 D789E probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mn1 A G 5: 111,421,785 Y1207C probably damaging Het
Mroh2b A G 15: 4,938,410 D977G possibly damaging Het
Mrpl53 A T 6: 83,109,188 N26I probably damaging Het
Nell1 A T 7: 50,220,012 probably null Het
Ogdh T G 11: 6,349,329 F743V probably benign Het
Olfr1424 A T 19: 12,058,858 M298K possibly damaging Het
Olfr732 C T 14: 50,281,579 V225I probably benign Het
Olfr788 A G 10: 129,473,084 T131A probably benign Het
Pmvk A G 3: 89,468,592 E174G probably benign Het
Pou6f2 T C 13: 18,239,573 N206D Het
Riok1 T A 13: 38,052,320 H347Q probably damaging Het
Ryr1 A G 7: 29,090,225 L1488P probably damaging Het
Slc9c1 A G 16: 45,539,713 I43M possibly damaging Het
Slmo1 A T 18: 67,472,948 S42C probably benign Het
Smarca2 A G 19: 26,676,680 N755S possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfb2m G A 1: 179,546,103 P10L probably benign Het
Trim30c T C 7: 104,383,496 M252V probably benign Het
Ttll1 A G 15: 83,500,078 L116P probably damaging Het
Tubd1 C T 11: 86,549,422 H91Y possibly damaging Het
Vgll4 A G 6: 114,862,825 S175P probably damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Vmn2r80 C T 10: 79,194,316 Q659* probably null Het
Zfp382 A G 7: 30,134,415 D497G possibly damaging Het
Zfp41 A G 15: 75,618,535 E112G probably damaging Het
Zfyve26 A G 12: 79,260,831 S1754P probably damaging Het
Other mutations in Shkbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Shkbp1 APN 7 27355251 missense probably benign 0.28
IGL01469:Shkbp1 APN 7 27355941 missense probably benign
IGL01787:Shkbp1 APN 7 27342450 missense possibly damaging 0.93
IGL02149:Shkbp1 APN 7 27342639 unclassified probably benign
IGL02902:Shkbp1 APN 7 27342716 missense probably damaging 0.97
R0086:Shkbp1 UTSW 7 27352026 missense probably benign 0.00
R0219:Shkbp1 UTSW 7 27352061 missense probably benign 0.01
R0485:Shkbp1 UTSW 7 27348581 missense probably damaging 1.00
R1036:Shkbp1 UTSW 7 27345296 missense possibly damaging 0.86
R1468:Shkbp1 UTSW 7 27345326 missense probably damaging 1.00
R1468:Shkbp1 UTSW 7 27345326 missense probably damaging 1.00
R1608:Shkbp1 UTSW 7 27354779 missense probably benign 0.01
R1757:Shkbp1 UTSW 7 27342351 missense probably benign
R1968:Shkbp1 UTSW 7 27355400 critical splice donor site probably null
R2763:Shkbp1 UTSW 7 27347029 missense probably benign 0.05
R3027:Shkbp1 UTSW 7 27343393 missense probably benign 0.18
R3924:Shkbp1 UTSW 7 27342402 missense probably benign
R4425:Shkbp1 UTSW 7 27343302 missense probably benign 0.38
R5048:Shkbp1 UTSW 7 27352096 unclassified probably benign
R5862:Shkbp1 UTSW 7 27343404 nonsense probably null
R5955:Shkbp1 UTSW 7 27342524 missense probably benign
R6016:Shkbp1 UTSW 7 27354401 missense possibly damaging 0.92
R6226:Shkbp1 UTSW 7 27351980 missense probably null 1.00
R6362:Shkbp1 UTSW 7 27351695 critical splice donor site probably null
R6382:Shkbp1 UTSW 7 27352059 nonsense probably null
R6460:Shkbp1 UTSW 7 27350538 missense probably benign 0.01
R6647:Shkbp1 UTSW 7 27342375 missense probably benign
R7025:Shkbp1 UTSW 7 27355281 missense possibly damaging 0.47
R7255:Shkbp1 UTSW 7 27342748 missense possibly damaging 0.93
R7522:Shkbp1 UTSW 7 27347158 missense possibly damaging 0.88
R7571:Shkbp1 UTSW 7 27347131 missense possibly damaging 0.90
Z1177:Shkbp1 UTSW 7 27347001 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTGAGTTCACACATGGAC -3'
(R):5'- CATTGAATGCTGAATCCCGG -3'

Sequencing Primer
(F):5'- TGGACCAGAGTAAGATCCTGTCTC -3'
(R):5'- TGAATCCCGGCACACAGAG -3'
Posted On2020-07-13