Incidental Mutation 'R8207:Zfp382'
ID635960
Institutional Source Beutler Lab
Gene Symbol Zfp382
Ensembl Gene ENSMUSG00000074220
Gene Namezinc finger protein 382
Synonyms5930415A09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R8207 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location30121942-30134950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30134415 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 497 (D497G)
Ref Sequence ENSEMBL: ENSMUSP00000096196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098596] [ENSMUST00000153792]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098596
AA Change: D497G

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096196
Gene: ENSMUSG00000074220
AA Change: D497G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
KRAB 42 102 3.36e-39 SMART
ZnF_C2H2 325 347 1.84e-4 SMART
ZnF_C2H2 353 375 7.26e-3 SMART
ZnF_C2H2 381 403 2.71e-2 SMART
ZnF_C2H2 409 431 4.47e-3 SMART
ZnF_C2H2 437 459 2.12e-4 SMART
ZnF_C2H2 465 487 3.95e-4 SMART
ZnF_C2H2 493 515 1.12e-3 SMART
ZnF_C2H2 521 543 2.57e-3 SMART
ZnF_C2H2 549 571 3.63e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153792
SMART Domains Protein: ENSMUSP00000123508
Gene: ENSMUSG00000074220

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a KRAB domain zinc finger transcription factor (KZNF). KZNFs play critical roles in the regulation of many cellular processes including differentiation, proliferation and apoptosis. The encoded protein inhibits activating protein 1 (AP-1) and nuclear factor kappa-B (NF-kB) signaling and may function as a tumor suppressor in multiple carcinomas. This gene is found in a cluster with other zinc finger protein genes on the long arm of chromosome 19, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T A 9: 92,351,008 F61L probably benign Het
Aen G A 7: 78,902,743 M150I possibly damaging Het
Arhgef11 A G 3: 87,698,775 N279S possibly damaging Het
Arid3a T C 10: 79,950,926 probably null Het
Casp8ap2 A G 4: 32,646,446 T1840A possibly damaging Het
Ccdc14 T A 16: 34,705,043 N235K possibly damaging Het
Cdh7 T C 1: 109,994,346 V56A probably damaging Het
Clec16a A G 16: 10,627,448 N518S probably benign Het
Clec16a G A 16: 10,694,710 R837H probably damaging Het
Cog7 T C 7: 121,977,292 D137G possibly damaging Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Efcab8 C G 2: 153,789,225 L192V probably damaging Het
Farp2 A G 1: 93,621,243 R1024G probably benign Het
Fmo1 T A 1: 162,850,107 T147S probably benign Het
Galnt13 A C 2: 54,880,110 I305L probably benign Het
Guca2a A G 4: 119,637,754 N2D unknown Het
Iqcd C T 5: 120,602,449 R282W probably damaging Het
Lamc1 A C 1: 153,250,522 C475G probably damaging Het
Map3k5 AAAAGAAAAAGA AA 10: 20,110,866 probably null Het
Med13 A T 11: 86,303,549 D789E probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mn1 A G 5: 111,421,785 Y1207C probably damaging Het
Mroh2b A G 15: 4,938,410 D977G possibly damaging Het
Mrpl53 A T 6: 83,109,188 N26I probably damaging Het
Ogdh T G 11: 6,349,329 F743V probably benign Het
Olfr1424 A T 19: 12,058,858 M298K possibly damaging Het
Olfr732 C T 14: 50,281,579 V225I probably benign Het
Olfr788 A G 10: 129,473,084 T131A probably benign Het
Pmvk A G 3: 89,468,592 E174G probably benign Het
Pou6f2 T C 13: 18,239,573 N206D Het
Riok1 T A 13: 38,052,320 H347Q probably damaging Het
Ryr1 A G 7: 29,090,225 L1488P probably damaging Het
Shkbp1 A G 7: 27,352,684 V158A probably benign Het
Slc9c1 A G 16: 45,539,713 I43M possibly damaging Het
Slmo1 A T 18: 67,472,948 S42C probably benign Het
Smarca2 A G 19: 26,676,680 N755S possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfb2m G A 1: 179,546,103 P10L probably benign Het
Trim30c T C 7: 104,383,496 M252V probably benign Het
Ttll1 A G 15: 83,500,078 L116P probably damaging Het
Tubd1 C T 11: 86,549,422 H91Y possibly damaging Het
Vgll4 A G 6: 114,862,825 S175P probably damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Vmn2r80 C T 10: 79,194,316 Q659* probably null Het
Zfp41 A G 15: 75,618,535 E112G probably damaging Het
Zfyve26 A G 12: 79,260,831 S1754P probably damaging Het
Other mutations in Zfp382
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02724:Zfp382 APN 7 30133737 missense probably benign 0.00
IGL03116:Zfp382 APN 7 30134189 missense probably damaging 1.00
R1051:Zfp382 UTSW 7 30134010 missense probably damaging 1.00
R1371:Zfp382 UTSW 7 30133689 missense probably benign 0.36
R1513:Zfp382 UTSW 7 30133296 missense probably benign 0.04
R1525:Zfp382 UTSW 7 30133719 missense probably damaging 0.99
R2416:Zfp382 UTSW 7 30134403 missense probably damaging 1.00
R2432:Zfp382 UTSW 7 30133749 missense probably benign
R4864:Zfp382 UTSW 7 30133460 missense possibly damaging 0.58
R4956:Zfp382 UTSW 7 30131554 missense probably benign 0.00
R5734:Zfp382 UTSW 7 30134430 missense probably damaging 1.00
R5796:Zfp382 UTSW 7 30133349 missense probably damaging 1.00
R6062:Zfp382 UTSW 7 30133590 missense probably damaging 1.00
R6300:Zfp382 UTSW 7 30131629 splice site probably null
R6312:Zfp382 UTSW 7 30134538 missense probably damaging 0.99
R6894:Zfp382 UTSW 7 30125836 missense probably benign
R7764:Zfp382 UTSW 7 30133275 missense probably benign 0.04
R7771:Zfp382 UTSW 7 30133335 missense probably damaging 1.00
R7794:Zfp382 UTSW 7 30131610 missense possibly damaging 0.84
R8267:Zfp382 UTSW 7 30134504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTACCTTATCGAGCACG -3'
(R):5'- GGGTAATGAGGTTCGATTTACAGC -3'

Sequencing Primer
(F):5'- GAGAAGCCCTACATTTGCTGTCAG -3'
(R):5'- GCTAAAGAATTTTCCACACTCTTGAC -3'
Posted On2020-07-13