Incidental Mutation 'R8207:Aen'
List |< first << previous [record 2 of 47] next >> last >|
ID635961
Institutional Source Beutler Lab
Gene Symbol Aen
Ensembl Gene ENSMUSG00000030609
Gene Nameapoptosis enhancing nuclease
SynonymsIsg20l1, 2700083B06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R8207 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location78895854-78911209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78902743 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 150 (M150I)
Ref Sequence ENSEMBL: ENSMUSP00000103046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107421] [ENSMUST00000107423] [ENSMUST00000107425] [ENSMUST00000138167] [ENSMUST00000205861] [ENSMUST00000205882]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107421
AA Change: M112I

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103044
Gene: ENSMUSG00000030609
AA Change: M112I

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
EXOIII 70 236 2.04e-42 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107423
AA Change: M150I

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103046
Gene: ENSMUSG00000030609
AA Change: M150I

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
EXOIII 108 274 2.04e-42 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107425
AA Change: M150I

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103048
Gene: ENSMUSG00000030609
AA Change: M150I

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
EXOIII 108 274 2.04e-42 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000138167
AA Change: M112I

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117331
Gene: ENSMUSG00000030609
AA Change: M112I

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
Pfam:RNase_T 72 138 1.9e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205861
AA Change: M55I

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000205882
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T A 9: 92,351,008 F61L probably benign Het
Arhgef11 A G 3: 87,698,775 N279S possibly damaging Het
Arid3a T C 10: 79,950,926 probably null Het
Casp8ap2 A G 4: 32,646,446 T1840A possibly damaging Het
Ccdc14 T A 16: 34,705,043 N235K possibly damaging Het
Cdh7 T C 1: 109,994,346 V56A probably damaging Het
Clec16a A G 16: 10,627,448 N518S probably benign Het
Clec16a G A 16: 10,694,710 R837H probably damaging Het
Cog7 T C 7: 121,977,292 D137G possibly damaging Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Efcab8 C G 2: 153,789,225 L192V probably damaging Het
Farp2 A G 1: 93,621,243 R1024G probably benign Het
Fmo1 T A 1: 162,850,107 T147S probably benign Het
Fryl A C 5: 73,100,500 probably null Het
Galnt13 A C 2: 54,880,110 I305L probably benign Het
Guca2a A G 4: 119,637,754 N2D unknown Het
Iqcd C T 5: 120,602,449 R282W probably damaging Het
Lamc1 A C 1: 153,250,522 C475G probably damaging Het
Map3k5 AAAAGAAAAAGA AA 10: 20,110,866 probably null Het
Med13 A T 11: 86,303,549 D789E probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mn1 A G 5: 111,421,785 Y1207C probably damaging Het
Mroh2b A G 15: 4,938,410 D977G possibly damaging Het
Mrpl53 A T 6: 83,109,188 N26I probably damaging Het
Nell1 A T 7: 50,220,012 probably null Het
Ogdh T G 11: 6,349,329 F743V probably benign Het
Olfr1424 A T 19: 12,058,858 M298K possibly damaging Het
Olfr732 C T 14: 50,281,579 V225I probably benign Het
Olfr788 A G 10: 129,473,084 T131A probably benign Het
Pmvk A G 3: 89,468,592 E174G probably benign Het
Pou6f2 T C 13: 18,239,573 N206D Het
Riok1 T A 13: 38,052,320 H347Q probably damaging Het
Ryr1 A G 7: 29,090,225 L1488P probably damaging Het
Shkbp1 A G 7: 27,352,684 V158A probably benign Het
Slc9c1 A G 16: 45,539,713 I43M possibly damaging Het
Slmo1 A T 18: 67,472,948 S42C probably benign Het
Smarca2 A G 19: 26,676,680 N755S possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfb2m G A 1: 179,546,103 P10L probably benign Het
Trim30c T C 7: 104,383,496 M252V probably benign Het
Ttll1 A G 15: 83,500,078 L116P probably damaging Het
Tubd1 C T 11: 86,549,422 H91Y possibly damaging Het
Vgll4 A G 6: 114,862,825 S175P probably damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Vmn2r80 C T 10: 79,194,316 Q659* probably null Het
Zfp382 A G 7: 30,134,415 D497G possibly damaging Het
Zfp41 A G 15: 75,618,535 E112G probably damaging Het
Zfyve26 A G 12: 79,260,831 S1754P probably damaging Het
Other mutations in Aen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Aen APN 7 78907302 missense probably damaging 0.96
IGL01062:Aen APN 7 78907302 missense probably damaging 0.96
IGL01065:Aen APN 7 78907302 missense probably damaging 0.96
IGL01067:Aen APN 7 78907302 missense probably damaging 0.96
IGL01068:Aen APN 7 78907302 missense probably damaging 0.96
IGL01069:Aen APN 7 78907302 missense probably damaging 0.96
IGL01070:Aen APN 7 78907302 missense probably damaging 0.96
IGL01086:Aen APN 7 78907302 missense probably damaging 0.96
IGL01089:Aen APN 7 78907302 missense probably damaging 0.96
IGL01126:Aen APN 7 78907302 missense probably damaging 0.96
IGL01128:Aen APN 7 78907302 missense probably damaging 0.96
IGL01133:Aen APN 7 78907302 missense probably damaging 0.96
IGL01134:Aen APN 7 78907302 missense probably damaging 0.96
IGL01147:Aen APN 7 78907302 missense probably damaging 0.96
R1433:Aen UTSW 7 78907312 missense probably damaging 1.00
R1543:Aen UTSW 7 78902622 missense probably damaging 1.00
R1615:Aen UTSW 7 78905912 missense probably damaging 1.00
R1886:Aen UTSW 7 78907325 missense probably damaging 0.98
R1887:Aen UTSW 7 78907325 missense probably damaging 0.98
R1918:Aen UTSW 7 78906029 missense possibly damaging 0.96
R1919:Aen UTSW 7 78905912 missense probably damaging 1.00
R1946:Aen UTSW 7 78902672 missense probably damaging 1.00
R2192:Aen UTSW 7 78906045 critical splice donor site probably null
R2224:Aen UTSW 7 78902451 missense probably benign 0.30
R2225:Aen UTSW 7 78902451 missense probably benign 0.30
R2226:Aen UTSW 7 78902451 missense probably benign 0.30
R2244:Aen UTSW 7 78907297 missense probably damaging 1.00
R2516:Aen UTSW 7 78905868 missense probably damaging 1.00
R4943:Aen UTSW 7 78902361 missense probably damaging 0.99
R5634:Aen UTSW 7 78902507 missense probably benign 0.01
R5834:Aen UTSW 7 78907301 missense probably damaging 1.00
R5961:Aen UTSW 7 78907159 missense probably damaging 1.00
R6130:Aen UTSW 7 78902639 splice site probably null
R6255:Aen UTSW 7 78905844 missense probably damaging 1.00
R6400:Aen UTSW 7 78907394 missense probably benign 0.02
R7303:Aen UTSW 7 78902456 missense possibly damaging 0.77
Z1177:Aen UTSW 7 78902766 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTGCCTTCACCATCACAGATG -3'
(R):5'- CCAGATACAAAGTGGTGCCTC -3'

Sequencing Primer
(F):5'- GCCTGTGCAGCAAAAAGTCTG -3'
(R):5'- AAAGTGGTGCCTCGAACC -3'
Posted On2020-07-13