Incidental Mutation 'R8207:Vmn2r80'
List |< first << previous [record 44 of 47] next >> last >|
ID635966
Institutional Source Beutler Lab
Gene Symbol Vmn2r80
Ensembl Gene ENSMUSG00000091888
Gene Namevomeronasal 2, receptor 80
SynonymsEG624765
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R8207 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79148797-79195012 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 79194316 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 659 (Q659*)
Ref Sequence ENSEMBL: ENSMUSP00000132299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165834]
Predicted Effect probably null
Transcript: ENSMUST00000165834
AA Change: Q659*
SMART Domains Protein: ENSMUSP00000132299
Gene: ENSMUSG00000091888
AA Change: Q659*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 79 474 1.5e-36 PFAM
Pfam:NCD3G 517 570 7.9e-22 PFAM
Pfam:7tm_3 603 838 6.2e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T A 9: 92,351,008 F61L probably benign Het
Aen G A 7: 78,902,743 M150I possibly damaging Het
Arhgef11 A G 3: 87,698,775 N279S possibly damaging Het
Arid3a T C 10: 79,950,926 probably null Het
Casp8ap2 A G 4: 32,646,446 T1840A possibly damaging Het
Ccdc14 T A 16: 34,705,043 N235K possibly damaging Het
Cdh7 T C 1: 109,994,346 V56A probably damaging Het
Clec16a A G 16: 10,627,448 N518S probably benign Het
Clec16a G A 16: 10,694,710 R837H probably damaging Het
Cog7 T C 7: 121,977,292 D137G possibly damaging Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Efcab8 C G 2: 153,789,225 L192V probably damaging Het
Farp2 A G 1: 93,621,243 R1024G probably benign Het
Fmo1 T A 1: 162,850,107 T147S probably benign Het
Fryl A C 5: 73,100,500 probably null Het
Galnt13 A C 2: 54,880,110 I305L probably benign Het
Guca2a A G 4: 119,637,754 N2D unknown Het
Iqcd C T 5: 120,602,449 R282W probably damaging Het
Lamc1 A C 1: 153,250,522 C475G probably damaging Het
Map3k5 AAAAGAAAAAGA AA 10: 20,110,866 probably null Het
Med13 A T 11: 86,303,549 D789E probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mn1 A G 5: 111,421,785 Y1207C probably damaging Het
Mroh2b A G 15: 4,938,410 D977G possibly damaging Het
Mrpl53 A T 6: 83,109,188 N26I probably damaging Het
Nell1 A T 7: 50,220,012 probably null Het
Ogdh T G 11: 6,349,329 F743V probably benign Het
Olfr1424 A T 19: 12,058,858 M298K possibly damaging Het
Olfr732 C T 14: 50,281,579 V225I probably benign Het
Olfr788 A G 10: 129,473,084 T131A probably benign Het
Pmvk A G 3: 89,468,592 E174G probably benign Het
Pou6f2 T C 13: 18,239,573 N206D Het
Riok1 T A 13: 38,052,320 H347Q probably damaging Het
Ryr1 A G 7: 29,090,225 L1488P probably damaging Het
Shkbp1 A G 7: 27,352,684 V158A probably benign Het
Slc9c1 A G 16: 45,539,713 I43M possibly damaging Het
Slmo1 A T 18: 67,472,948 S42C probably benign Het
Smarca2 A G 19: 26,676,680 N755S possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfb2m G A 1: 179,546,103 P10L probably benign Het
Trim30c T C 7: 104,383,496 M252V probably benign Het
Ttll1 A G 15: 83,500,078 L116P probably damaging Het
Tubd1 C T 11: 86,549,422 H91Y possibly damaging Het
Vgll4 A G 6: 114,862,825 S175P probably damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Zfp382 A G 7: 30,134,415 D497G possibly damaging Het
Zfp41 A G 15: 75,618,535 E112G probably damaging Het
Zfyve26 A G 12: 79,260,831 S1754P probably damaging Het
Other mutations in Vmn2r80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Vmn2r80 APN 10 79194599 missense probably damaging 1.00
IGL01325:Vmn2r80 APN 10 79194247 missense possibly damaging 0.62
IGL01611:Vmn2r80 APN 10 79171654 missense probably damaging 1.00
IGL01799:Vmn2r80 APN 10 79171551 missense possibly damaging 0.95
IGL01877:Vmn2r80 APN 10 79171500 splice site probably null
IGL02673:Vmn2r80 APN 10 79169484 missense probably benign 0.02
IGL02756:Vmn2r80 APN 10 79194311 missense probably damaging 1.00
IGL02820:Vmn2r80 APN 10 79171605 missense probably benign 0.04
IGL03382:Vmn2r80 APN 10 79169528 missense probably damaging 1.00
R0071:Vmn2r80 UTSW 10 79171732 missense possibly damaging 0.83
R0071:Vmn2r80 UTSW 10 79171732 missense possibly damaging 0.83
R0129:Vmn2r80 UTSW 10 79169496 missense probably damaging 1.00
R0325:Vmn2r80 UTSW 10 79148939 missense possibly damaging 0.89
R0567:Vmn2r80 UTSW 10 79194831 missense possibly damaging 0.89
R1510:Vmn2r80 UTSW 10 79169719 missense possibly damaging 0.69
R1519:Vmn2r80 UTSW 10 79194219 missense probably damaging 1.00
R1520:Vmn2r80 UTSW 10 79194760 missense probably damaging 1.00
R1627:Vmn2r80 UTSW 10 79194415 missense probably damaging 1.00
R1709:Vmn2r80 UTSW 10 79194389 missense probably benign 0.04
R2116:Vmn2r80 UTSW 10 79194724 missense probably benign 0.09
R2237:Vmn2r80 UTSW 10 79168270 missense probably damaging 1.00
R2308:Vmn2r80 UTSW 10 79171621 missense probably damaging 1.00
R2893:Vmn2r80 UTSW 10 79148865 missense possibly damaging 0.63
R3408:Vmn2r80 UTSW 10 79168393 missense possibly damaging 0.95
R4502:Vmn2r80 UTSW 10 79148930 missense probably benign 0.00
R4685:Vmn2r80 UTSW 10 79194328 missense possibly damaging 0.95
R4851:Vmn2r80 UTSW 10 79194322 missense possibly damaging 0.68
R4947:Vmn2r80 UTSW 10 79194698 missense probably damaging 1.00
R5112:Vmn2r80 UTSW 10 79194458 missense possibly damaging 0.61
R5217:Vmn2r80 UTSW 10 79169146 missense possibly damaging 0.62
R5226:Vmn2r80 UTSW 10 79194040 missense probably benign 0.36
R5512:Vmn2r80 UTSW 10 79168232 missense probably benign 0.00
R5618:Vmn2r80 UTSW 10 79148921 missense probably benign
R5959:Vmn2r80 UTSW 10 79169479 missense probably benign 0.00
R6104:Vmn2r80 UTSW 10 79149020 missense probably benign 0.00
R6110:Vmn2r80 UTSW 10 79182003 missense probably damaging 1.00
R6270:Vmn2r80 UTSW 10 79194325 missense probably benign 0.00
R6508:Vmn2r80 UTSW 10 79194456 missense probably benign 0.03
R6843:Vmn2r80 UTSW 10 79169668 missense probably benign 0.08
R6894:Vmn2r80 UTSW 10 79169604 missense probably benign 0.06
R7048:Vmn2r80 UTSW 10 79194319 missense probably damaging 1.00
R7149:Vmn2r80 UTSW 10 79194820 missense probably benign 0.00
R7262:Vmn2r80 UTSW 10 79169745 missense probably damaging 0.98
R7559:Vmn2r80 UTSW 10 79194625 missense probably benign 0.00
R7622:Vmn2r80 UTSW 10 79194263 missense probably damaging 1.00
R8003:Vmn2r80 UTSW 10 79148877 missense probably benign 0.16
R8330:Vmn2r80 UTSW 10 79171716 missense probably damaging 1.00
R8337:Vmn2r80 UTSW 10 79148873 missense probably benign 0.00
Z1176:Vmn2r80 UTSW 10 79169477 missense not run
Z1176:Vmn2r80 UTSW 10 79194398 missense possibly damaging 0.65
Z1176:Vmn2r80 UTSW 10 79194607 missense probably damaging 1.00
Z1176:Vmn2r80 UTSW 10 79194771 missense probably damaging 1.00
Z1177:Vmn2r80 UTSW 10 79169477 missense not run
Predicted Primers PCR Primer
(F):5'- CTGTCCTATGATGATCCCCTGG -3'
(R):5'- CCAGAGAGAAGTATTTGTATCAGGG -3'

Sequencing Primer
(F):5'- AGGGAATCACACTTCTTTCCATTGG -3'
(R):5'- ATTTGTATCAGGGTGCAAACTG -3'
Posted On2020-07-13