Incidental Mutation 'R8207:Arid3a'
ID635967
Institutional Source Beutler Lab
Gene Symbol Arid3a
Ensembl Gene ENSMUSG00000019564
Gene NameAT rich interactive domain 3A (BRIGHT-like)
SynonymsDri1, Bright
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8207 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location79927043-79955018 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 79950926 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000019708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019708] [ENSMUST00000105376] [ENSMUST00000105377]
Predicted Effect probably null
Transcript: ENSMUST00000019708
SMART Domains Protein: ENSMUSP00000019708
Gene: ENSMUSG00000019564

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 27 34 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
coiled coil region 133 167 N/A INTRINSIC
ARID 240 331 2.1e-36 SMART
BRIGHT 244 336 7.73e-42 SMART
coiled coil region 436 462 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
low complexity region 555 583 N/A INTRINSIC
low complexity region 588 599 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105376
SMART Domains Protein: ENSMUSP00000101015
Gene: ENSMUSG00000019564

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 27 34 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
coiled coil region 133 167 N/A INTRINSIC
ARID 240 331 2.1e-36 SMART
BRIGHT 244 336 7.73e-42 SMART
coiled coil region 436 462 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
low complexity region 555 583 N/A INTRINSIC
low complexity region 588 599 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105377
SMART Domains Protein: ENSMUSP00000101016
Gene: ENSMUSG00000019564

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 27 34 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
coiled coil region 133 167 N/A INTRINSIC
ARID 240 331 2.1e-36 SMART
BRIGHT 244 336 7.73e-42 SMART
coiled coil region 434 460 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 553 581 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ARID (AT-rich interaction domain) family of DNA binding proteins. It was found by homology to the Drosophila dead ringer gene, which is important for normal embryogenesis. Other ARID family members have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation, and possibly in chromatin structure modification. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E11.5 and E13.5 due to impaired erythropoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T A 9: 92,351,008 F61L probably benign Het
Aen G A 7: 78,902,743 M150I possibly damaging Het
Arhgef11 A G 3: 87,698,775 N279S possibly damaging Het
Casp8ap2 A G 4: 32,646,446 T1840A possibly damaging Het
Ccdc14 T A 16: 34,705,043 N235K possibly damaging Het
Cdh7 T C 1: 109,994,346 V56A probably damaging Het
Clec16a A G 16: 10,627,448 N518S probably benign Het
Clec16a G A 16: 10,694,710 R837H probably damaging Het
Cog7 T C 7: 121,977,292 D137G possibly damaging Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Efcab8 C G 2: 153,789,225 L192V probably damaging Het
Farp2 A G 1: 93,621,243 R1024G probably benign Het
Fmo1 T A 1: 162,850,107 T147S probably benign Het
Galnt13 A C 2: 54,880,110 I305L probably benign Het
Guca2a A G 4: 119,637,754 N2D unknown Het
Iqcd C T 5: 120,602,449 R282W probably damaging Het
Lamc1 A C 1: 153,250,522 C475G probably damaging Het
Map3k5 AAAAGAAAAAGA AA 10: 20,110,866 probably null Het
Med13 A T 11: 86,303,549 D789E probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mn1 A G 5: 111,421,785 Y1207C probably damaging Het
Mroh2b A G 15: 4,938,410 D977G possibly damaging Het
Mrpl53 A T 6: 83,109,188 N26I probably damaging Het
Ogdh T G 11: 6,349,329 F743V probably benign Het
Olfr1424 A T 19: 12,058,858 M298K possibly damaging Het
Olfr732 C T 14: 50,281,579 V225I probably benign Het
Olfr788 A G 10: 129,473,084 T131A probably benign Het
Pmvk A G 3: 89,468,592 E174G probably benign Het
Pou6f2 T C 13: 18,239,573 N206D Het
Riok1 T A 13: 38,052,320 H347Q probably damaging Het
Ryr1 A G 7: 29,090,225 L1488P probably damaging Het
Shkbp1 A G 7: 27,352,684 V158A probably benign Het
Slc9c1 A G 16: 45,539,713 I43M possibly damaging Het
Slmo1 A T 18: 67,472,948 S42C probably benign Het
Smarca2 A G 19: 26,676,680 N755S possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfb2m G A 1: 179,546,103 P10L probably benign Het
Trim30c T C 7: 104,383,496 M252V probably benign Het
Ttll1 A G 15: 83,500,078 L116P probably damaging Het
Tubd1 C T 11: 86,549,422 H91Y possibly damaging Het
Vgll4 A G 6: 114,862,825 S175P probably damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Vmn2r80 C T 10: 79,194,316 Q659* probably null Het
Zfp382 A G 7: 30,134,415 D497G possibly damaging Het
Zfp41 A G 15: 75,618,535 E112G probably damaging Het
Zfyve26 A G 12: 79,260,831 S1754P probably damaging Het
Other mutations in Arid3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Arid3a APN 10 79950634 missense probably damaging 0.98
IGL02563:Arid3a APN 10 79950883 missense probably damaging 0.99
IGL03144:Arid3a APN 10 79946482 splice site probably benign
IGL03228:Arid3a APN 10 79950744 missense possibly damaging 0.80
IGL03347:Arid3a APN 10 79951279 missense possibly damaging 0.65
R0049:Arid3a UTSW 10 79931065 missense possibly damaging 0.66
R0408:Arid3a UTSW 10 79950833 missense probably benign 0.00
R0479:Arid3a UTSW 10 79951294 missense possibly damaging 0.80
R1938:Arid3a UTSW 10 79950706 missense probably damaging 0.99
R2190:Arid3a UTSW 10 79946531 missense possibly damaging 0.80
R4628:Arid3a UTSW 10 79931158 missense possibly damaging 0.95
R5184:Arid3a UTSW 10 79950769 missense possibly damaging 0.73
R7014:Arid3a UTSW 10 79950884 missense possibly damaging 0.50
R7966:Arid3a UTSW 10 79932055 missense probably benign 0.02
Z1177:Arid3a UTSW 10 79949430 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGTATCTTTGGCAGGCC -3'
(R):5'- TCCTCTAGAAGGCCTTTTCCAAG -3'

Sequencing Primer
(F):5'- ACCCTGTTGTCGCAGCC -3'
(R):5'- GAACAGGCATCTTTATGTAGCTC -3'
Posted On2020-07-13