Incidental Mutation 'R8207:Tubd1'
ID635971
Institutional Source Beutler Lab
Gene Symbol Tubd1
Ensembl Gene ENSMUSG00000020513
Gene Nametubulin, delta 1
Synonyms4930550G19Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001199045.1, NM_019756.3, NM_001199046.1, NM_001199047.1; MGI:1891826

Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R8207 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location86544991-86567360 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86549422 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 91 (H91Y)
Ref Sequence ENSEMBL: ENSMUSP00000020821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020821] [ENSMUST00000058286] [ENSMUST00000069503] [ENSMUST00000108030] [ENSMUST00000138810] [ENSMUST00000154617] [ENSMUST00000167178]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020821
AA Change: H91Y

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020821
Gene: ENSMUSG00000020513
AA Change: H91Y

DomainStartEndE-ValueType
Tubulin 47 246 2.91e-30 SMART
Blast:Tubulin 273 323 1e-12 BLAST
SCOP:d1tubb2 289 481 6e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000058286
SMART Domains Protein: ENSMUSP00000053188
Gene: ENSMUSG00000020516

DomainStartEndE-ValueType
Pfam:Pkinase 91 202 1.2e-19 PFAM
Pfam:Pkinase_Tyr 91 253 5.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069503
AA Change: H91Y

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000064383
Gene: ENSMUSG00000020513
AA Change: H91Y

DomainStartEndE-ValueType
Tubulin 47 246 2.91e-30 SMART
SCOP:d1tubb2 256 450 1e-25 SMART
Blast:Tubulin 258 292 1e-11 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000108030
AA Change: H91Y

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103665
Gene: ENSMUSG00000020513
AA Change: H91Y

DomainStartEndE-ValueType
Tubulin 47 246 2.91e-30 SMART
Blast:Tubulin 273 323 1e-12 BLAST
SCOP:d1tubb2 289 481 6e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138810
SMART Domains Protein: ENSMUSP00000122756
Gene: ENSMUSG00000020516

DomainStartEndE-ValueType
SCOP:d1koba_ 13 74 9e-13 SMART
PDB:4L3L|A 21 74 6e-30 PDB
Blast:S_TKc 38 74 7e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154617
SMART Domains Protein: ENSMUSP00000119715
Gene: ENSMUSG00000020516

DomainStartEndE-ValueType
S_TKc 91 352 8.24e-107 SMART
S_TK_X 353 415 9.2e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167178
AA Change: H91Y

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000130909
Gene: ENSMUSG00000020513
AA Change: H91Y

DomainStartEndE-ValueType
Tubulin 47 246 2.91e-30 SMART
SCOP:d1tubb2 256 450 1e-25 SMART
Blast:Tubulin 258 292 1e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T A 9: 92,351,008 F61L probably benign Het
Aen G A 7: 78,902,743 M150I possibly damaging Het
Arhgef11 A G 3: 87,698,775 N279S possibly damaging Het
Arid3a T C 10: 79,950,926 probably null Het
Casp8ap2 A G 4: 32,646,446 T1840A possibly damaging Het
Ccdc14 T A 16: 34,705,043 N235K possibly damaging Het
Cdh7 T C 1: 109,994,346 V56A probably damaging Het
Clec16a A G 16: 10,627,448 N518S probably benign Het
Clec16a G A 16: 10,694,710 R837H probably damaging Het
Cog7 T C 7: 121,977,292 D137G possibly damaging Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Efcab8 C G 2: 153,789,225 L192V probably damaging Het
Farp2 A G 1: 93,621,243 R1024G probably benign Het
Fmo1 T A 1: 162,850,107 T147S probably benign Het
Galnt13 A C 2: 54,880,110 I305L probably benign Het
Guca2a A G 4: 119,637,754 N2D unknown Het
Iqcd C T 5: 120,602,449 R282W probably damaging Het
Lamc1 A C 1: 153,250,522 C475G probably damaging Het
Map3k5 AAAAGAAAAAGA AA 10: 20,110,866 probably null Het
Med13 A T 11: 86,303,549 D789E probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mn1 A G 5: 111,421,785 Y1207C probably damaging Het
Mroh2b A G 15: 4,938,410 D977G possibly damaging Het
Mrpl53 A T 6: 83,109,188 N26I probably damaging Het
Ogdh T G 11: 6,349,329 F743V probably benign Het
Olfr1424 A T 19: 12,058,858 M298K possibly damaging Het
Olfr732 C T 14: 50,281,579 V225I probably benign Het
Olfr788 A G 10: 129,473,084 T131A probably benign Het
Pmvk A G 3: 89,468,592 E174G probably benign Het
Pou6f2 T C 13: 18,239,573 N206D Het
Riok1 T A 13: 38,052,320 H347Q probably damaging Het
Ryr1 A G 7: 29,090,225 L1488P probably damaging Het
Shkbp1 A G 7: 27,352,684 V158A probably benign Het
Slc9c1 A G 16: 45,539,713 I43M possibly damaging Het
Slmo1 A T 18: 67,472,948 S42C probably benign Het
Smarca2 A G 19: 26,676,680 N755S possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfb2m G A 1: 179,546,103 P10L probably benign Het
Trim30c T C 7: 104,383,496 M252V probably benign Het
Ttll1 A G 15: 83,500,078 L116P probably damaging Het
Vgll4 A G 6: 114,862,825 S175P probably damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Vmn2r80 C T 10: 79,194,316 Q659* probably null Het
Zfp382 A G 7: 30,134,415 D497G possibly damaging Het
Zfp41 A G 15: 75,618,535 E112G probably damaging Het
Zfyve26 A G 12: 79,260,831 S1754P probably damaging Het
Other mutations in Tubd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Tubd1 APN 11 86565729 missense probably benign 0.07
IGL00465:Tubd1 APN 11 86555068 splice site probably benign
IGL03088:Tubd1 APN 11 86552999 missense probably damaging 1.00
IGL03383:Tubd1 APN 11 86549008 splice site probably benign
R0039:Tubd1 UTSW 11 86549395 nonsense probably null
R0427:Tubd1 UTSW 11 86557790 missense possibly damaging 0.94
R0482:Tubd1 UTSW 11 86557776 missense possibly damaging 0.89
R2305:Tubd1 UTSW 11 86555191 missense probably benign 0.38
R4153:Tubd1 UTSW 11 86549470 missense probably damaging 1.00
R4436:Tubd1 UTSW 11 86548919 missense probably benign 0.02
R4773:Tubd1 UTSW 11 86555302 missense possibly damaging 0.83
R4793:Tubd1 UTSW 11 86567069 missense probably benign 0.19
R4890:Tubd1 UTSW 11 86552795 missense possibly damaging 0.83
R4908:Tubd1 UTSW 11 86567053 missense probably damaging 1.00
R4990:Tubd1 UTSW 11 86557839 missense probably damaging 1.00
R5004:Tubd1 UTSW 11 86561320 missense probably damaging 0.98
R6192:Tubd1 UTSW 11 86557793 missense probably benign 0.32
R7108:Tubd1 UTSW 11 86557805 missense probably damaging 0.99
R8254:Tubd1 UTSW 11 86549438 missense probably damaging 1.00
Z1088:Tubd1 UTSW 11 86555167 missense probably damaging 1.00
Z1088:Tubd1 UTSW 11 86549470 missense probably damaging 1.00
Z1176:Tubd1 UTSW 11 86549405 missense possibly damaging 0.94
Z1177:Tubd1 UTSW 11 86552898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGAATATGGTTCAGTGACTTAG -3'
(R):5'- GAGTTGAACCAGTCAGAGCTC -3'

Sequencing Primer
(F):5'- AGAAGTTTACGCTCTGTGGTACCC -3'
(R):5'- TCTCAGAGGCTGAAAACATTCTAGGC -3'
Posted On2020-07-13