Incidental Mutation 'R8207:Pou6f2'
ID635974
Institutional Source Beutler Lab
Gene Symbol Pou6f2
Ensembl Gene ENSMUSG00000009734
Gene NamePOU domain, class 6, transcription factor 2
SynonymsRPF-1, D130006K24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8207 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location18121098-18397686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18239573 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 206 (N206D)
Gene Model predicted gene model for transcript(s):
Predicted Effect
SMART Domains Protein: ENSMUSP00000114173
Gene: ENSMUSG00000009734
AA Change: N206D

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
coiled coil region 107 143 N/A INTRINSIC
low complexity region 248 266 N/A INTRINSIC
POU 422 532 9.61e-26 SMART
HOX 553 615 3.01e-21 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and of normal size with no apparent phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T A 9: 92,351,008 F61L probably benign Het
Aen G A 7: 78,902,743 M150I possibly damaging Het
Arhgef11 A G 3: 87,698,775 N279S possibly damaging Het
Arid3a T C 10: 79,950,926 probably null Het
Casp8ap2 A G 4: 32,646,446 T1840A possibly damaging Het
Ccdc14 T A 16: 34,705,043 N235K possibly damaging Het
Cdh7 T C 1: 109,994,346 V56A probably damaging Het
Clec16a A G 16: 10,627,448 N518S probably benign Het
Clec16a G A 16: 10,694,710 R837H probably damaging Het
Cog7 T C 7: 121,977,292 D137G possibly damaging Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Efcab8 C G 2: 153,789,225 L192V probably damaging Het
Farp2 A G 1: 93,621,243 R1024G probably benign Het
Fmo1 T A 1: 162,850,107 T147S probably benign Het
Galnt13 A C 2: 54,880,110 I305L probably benign Het
Guca2a A G 4: 119,637,754 N2D unknown Het
Iqcd C T 5: 120,602,449 R282W probably damaging Het
Lamc1 A C 1: 153,250,522 C475G probably damaging Het
Map3k5 AAAAGAAAAAGA AA 10: 20,110,866 probably null Het
Med13 A T 11: 86,303,549 D789E probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mn1 A G 5: 111,421,785 Y1207C probably damaging Het
Mroh2b A G 15: 4,938,410 D977G possibly damaging Het
Mrpl53 A T 6: 83,109,188 N26I probably damaging Het
Ogdh T G 11: 6,349,329 F743V probably benign Het
Olfr1424 A T 19: 12,058,858 M298K possibly damaging Het
Olfr732 C T 14: 50,281,579 V225I probably benign Het
Olfr788 A G 10: 129,473,084 T131A probably benign Het
Pmvk A G 3: 89,468,592 E174G probably benign Het
Riok1 T A 13: 38,052,320 H347Q probably damaging Het
Ryr1 A G 7: 29,090,225 L1488P probably damaging Het
Shkbp1 A G 7: 27,352,684 V158A probably benign Het
Slc9c1 A G 16: 45,539,713 I43M possibly damaging Het
Slmo1 A T 18: 67,472,948 S42C probably benign Het
Smarca2 A G 19: 26,676,680 N755S possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfb2m G A 1: 179,546,103 P10L probably benign Het
Trim30c T C 7: 104,383,496 M252V probably benign Het
Ttll1 A G 15: 83,500,078 L116P probably damaging Het
Tubd1 C T 11: 86,549,422 H91Y possibly damaging Het
Vgll4 A G 6: 114,862,825 S175P probably damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Vmn2r80 C T 10: 79,194,316 Q659* probably null Het
Zfp382 A G 7: 30,134,415 D497G possibly damaging Het
Zfp41 A G 15: 75,618,535 E112G probably damaging Het
Zfyve26 A G 12: 79,260,831 S1754P probably damaging Het
Other mutations in Pou6f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Pou6f2 APN 13 18139585 missense probably damaging 1.00
IGL03046:Pou6f2 UTSW 13 18129027 utr 3 prime probably benign
PIT4402001:Pou6f2 UTSW 13 18125346 missense
PIT4519001:Pou6f2 UTSW 13 18239564 missense unknown
R0349:Pou6f2 UTSW 13 18152004 missense probably damaging 1.00
R0510:Pou6f2 UTSW 13 18139723 splice site probably benign
R1449:Pou6f2 UTSW 13 18172415 missense probably damaging 1.00
R1911:Pou6f2 UTSW 13 18151963 missense probably damaging 0.98
R2971:Pou6f2 UTSW 13 18381967 missense unknown
R5193:Pou6f2 UTSW 13 18125544 utr 3 prime probably benign
R5218:Pou6f2 UTSW 13 18152001 missense probably damaging 1.00
R6226:Pou6f2 UTSW 13 18129154 missense possibly damaging 0.83
R6747:Pou6f2 UTSW 13 18129187 missense probably benign 0.26
R6805:Pou6f2 UTSW 13 18239489 missense
R6978:Pou6f2 UTSW 13 18172478 missense probably damaging 1.00
R7072:Pou6f2 UTSW 13 18125169 missense
R7158:Pou6f2 UTSW 13 18152038 missense
R7187:Pou6f2 UTSW 13 18239713 missense
R7198:Pou6f2 UTSW 13 18129163 missense probably damaging 0.97
R7203:Pou6f2 UTSW 13 18239794 missense unknown
R7241:Pou6f2 UTSW 13 18125289 missense
R7307:Pou6f2 UTSW 13 18239713 missense
R7827:Pou6f2 UTSW 13 18378507 missense
R7895:Pou6f2 UTSW 13 18125448 missense
R8070:Pou6f2 UTSW 13 18239624 missense unknown
R8334:Pou6f2 UTSW 13 18125406 missense probably damaging 1.00
Z1176:Pou6f2 UTSW 13 18378635 missense unknown
Predicted Primers PCR Primer
(F):5'- GATGCTATGTCTTGCTGGCC -3'
(R):5'- TGAACTCCCAGCTGCAACAG -3'

Sequencing Primer
(F):5'- CTTCTGCCTGTGGGGACTGTAC -3'
(R):5'- GCAACTCCAGCTGCAACAG -3'
Posted On2020-07-13