Incidental Mutation 'R8207:Olfr732'
List |< first << previous [record 27 of 47] next >> last >|
ID635976
Institutional Source Beutler Lab
Gene Symbol Olfr732
Ensembl Gene ENSMUSG00000091873
Gene Nameolfactory receptor 732
SynonymsGA_x6K02T2PMLR-5975274-5974348, MOR241-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R8207 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50278473-50284206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50281579 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 225 (V225I)
Ref Sequence ENSEMBL: ENSMUSP00000071195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071208]
Predicted Effect probably benign
Transcript: ENSMUST00000071208
AA Change: V225I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000071195
Gene: ENSMUSG00000091873
AA Change: V225I

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 7.4e-45 PFAM
Pfam:7tm_1 41 288 4.5e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T A 9: 92,351,008 F61L probably benign Het
Aen G A 7: 78,902,743 M150I possibly damaging Het
Arhgef11 A G 3: 87,698,775 N279S possibly damaging Het
Arid3a T C 10: 79,950,926 probably null Het
Casp8ap2 A G 4: 32,646,446 T1840A possibly damaging Het
Ccdc14 T A 16: 34,705,043 N235K possibly damaging Het
Cdh7 T C 1: 109,994,346 V56A probably damaging Het
Clec16a A G 16: 10,627,448 N518S probably benign Het
Clec16a G A 16: 10,694,710 R837H probably damaging Het
Cog7 T C 7: 121,977,292 D137G possibly damaging Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Efcab8 C G 2: 153,789,225 L192V probably damaging Het
Farp2 A G 1: 93,621,243 R1024G probably benign Het
Fmo1 T A 1: 162,850,107 T147S probably benign Het
Fryl A C 5: 73,100,500 probably null Het
Galnt13 A C 2: 54,880,110 I305L probably benign Het
Guca2a A G 4: 119,637,754 N2D unknown Het
Iqcd C T 5: 120,602,449 R282W probably damaging Het
Lamc1 A C 1: 153,250,522 C475G probably damaging Het
Map3k5 AAAAGAAAAAGA AA 10: 20,110,866 probably null Het
Med13 A T 11: 86,303,549 D789E probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mn1 A G 5: 111,421,785 Y1207C probably damaging Het
Mroh2b A G 15: 4,938,410 D977G possibly damaging Het
Mrpl53 A T 6: 83,109,188 N26I probably damaging Het
Nell1 A T 7: 50,220,012 probably null Het
Ogdh T G 11: 6,349,329 F743V probably benign Het
Olfr1424 A T 19: 12,058,858 M298K possibly damaging Het
Olfr788 A G 10: 129,473,084 T131A probably benign Het
Pmvk A G 3: 89,468,592 E174G probably benign Het
Pou6f2 T C 13: 18,239,573 N206D Het
Riok1 T A 13: 38,052,320 H347Q probably damaging Het
Ryr1 A G 7: 29,090,225 L1488P probably damaging Het
Shkbp1 A G 7: 27,352,684 V158A probably benign Het
Slc9c1 A G 16: 45,539,713 I43M possibly damaging Het
Slmo1 A T 18: 67,472,948 S42C probably benign Het
Smarca2 A G 19: 26,676,680 N755S possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfb2m G A 1: 179,546,103 P10L probably benign Het
Trim30c T C 7: 104,383,496 M252V probably benign Het
Ttll1 A G 15: 83,500,078 L116P probably damaging Het
Tubd1 C T 11: 86,549,422 H91Y possibly damaging Het
Vgll4 A G 6: 114,862,825 S175P probably damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Vmn2r80 C T 10: 79,194,316 Q659* probably null Het
Zfp382 A G 7: 30,134,415 D497G possibly damaging Het
Zfp41 A G 15: 75,618,535 E112G probably damaging Het
Zfyve26 A G 12: 79,260,831 S1754P probably damaging Het
Other mutations in Olfr732
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Olfr732 APN 14 50282232 missense probably damaging 0.99
IGL01801:Olfr732 APN 14 50282208 missense probably benign
IGL01992:Olfr732 APN 14 50281341 missense probably benign 0.09
IGL02137:Olfr732 APN 14 50281678 missense probably benign 0.16
IGL02494:Olfr732 APN 14 50282226 missense probably damaging 1.00
IGL02606:Olfr732 APN 14 50282073 missense probably damaging 1.00
IGL02799:Olfr732 UTSW 14 50281344 missense probably benign
PIT4142001:Olfr732 UTSW 14 50281327 makesense probably null
R0570:Olfr732 UTSW 14 50281913 missense probably benign 0.00
R1570:Olfr732 UTSW 14 50281524 missense probably damaging 1.00
R1860:Olfr732 UTSW 14 50281391 nonsense probably null
R2313:Olfr732 UTSW 14 50281974 missense probably damaging 1.00
R4594:Olfr732 UTSW 14 50281683 missense probably benign 0.02
R6442:Olfr732 UTSW 14 50281369 missense probably damaging 0.98
R6783:Olfr732 UTSW 14 50282187 missense probably benign
R7334:Olfr732 UTSW 14 50281579 missense probably benign 0.08
R7763:Olfr732 UTSW 14 50281488 missense probably damaging 1.00
R8228:Olfr732 UTSW 14 50281540 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTATAAATCACAGGATTCATCAGTGG -3'
(R):5'- CTGGCTTGGAGGATTTATTCAC -3'

Sequencing Primer
(F):5'- ACAGGATTCATCAGTGGAAATATTAC -3'
(R):5'- TGGAGGATTTATTCACTCCATTATTC -3'
Posted On2020-07-13