Incidental Mutation 'R8207:Cpt1b'
ID635980
Institutional Source Beutler Lab
Gene Symbol Cpt1b
Ensembl Gene ENSMUSG00000078937
Gene Namecarnitine palmitoyltransferase 1b, muscle
SynonymsM-CPTI, M-CPT I, Cpt1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8207 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location89416405-89425863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89418815 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 649 (T649A)
Ref Sequence ENSEMBL: ENSMUSP00000104936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052315] [ENSMUST00000109313]
Predicted Effect probably benign
Transcript: ENSMUST00000052315
Predicted Effect probably damaging
Transcript: ENSMUST00000109313
AA Change: T649A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104936
Gene: ENSMUSG00000078937
AA Change: T649A

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.5e-29 PFAM
Pfam:Carn_acyltransf 173 762 1.3e-183 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165419
Predicted Effect probably benign
Transcript: ENSMUST00000168879
SMART Domains Protein: ENSMUSP00000128188
Gene: ENSMUSG00000078937

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 3 148 3.5e-34 PFAM
Meta Mutation Damage Score 0.2747 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the carnitine/choline acetyltransferase family, is the rate-controlling enzyme of the long-chain fatty acid beta-oxidation pathway in muscle mitochondria. This enzyme is required for the net transport of long-chain fatty acyl-CoAs from the cytoplasm into the mitochondria. Multiple transcript variants encoding different isoforms have been found for this gene, and read-through transcripts are expressed from the upstream locus that include exons from this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygous null mice die in utero prior to E9.5. Heterozygous mutant mice exhibit susceptibility to fatal hypothermia following cold exposure, with females more severely affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T A 9: 92,351,008 F61L probably benign Het
Aen G A 7: 78,902,743 M150I possibly damaging Het
Arhgef11 A G 3: 87,698,775 N279S possibly damaging Het
Arid3a T C 10: 79,950,926 probably null Het
Casp8ap2 A G 4: 32,646,446 T1840A possibly damaging Het
Ccdc14 T A 16: 34,705,043 N235K possibly damaging Het
Cdh7 T C 1: 109,994,346 V56A probably damaging Het
Clec16a A G 16: 10,627,448 N518S probably benign Het
Clec16a G A 16: 10,694,710 R837H probably damaging Het
Cog7 T C 7: 121,977,292 D137G possibly damaging Het
Efcab8 C G 2: 153,789,225 L192V probably damaging Het
Farp2 A G 1: 93,621,243 R1024G probably benign Het
Fmo1 T A 1: 162,850,107 T147S probably benign Het
Galnt13 A C 2: 54,880,110 I305L probably benign Het
Guca2a A G 4: 119,637,754 N2D unknown Het
Iqcd C T 5: 120,602,449 R282W probably damaging Het
Lamc1 A C 1: 153,250,522 C475G probably damaging Het
Map3k5 AAAAGAAAAAGA AA 10: 20,110,866 probably null Het
Med13 A T 11: 86,303,549 D789E probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mn1 A G 5: 111,421,785 Y1207C probably damaging Het
Mroh2b A G 15: 4,938,410 D977G possibly damaging Het
Mrpl53 A T 6: 83,109,188 N26I probably damaging Het
Ogdh T G 11: 6,349,329 F743V probably benign Het
Olfr1424 A T 19: 12,058,858 M298K possibly damaging Het
Olfr732 C T 14: 50,281,579 V225I probably benign Het
Olfr788 A G 10: 129,473,084 T131A probably benign Het
Pmvk A G 3: 89,468,592 E174G probably benign Het
Pou6f2 T C 13: 18,239,573 N206D Het
Riok1 T A 13: 38,052,320 H347Q probably damaging Het
Ryr1 A G 7: 29,090,225 L1488P probably damaging Het
Shkbp1 A G 7: 27,352,684 V158A probably benign Het
Slc9c1 A G 16: 45,539,713 I43M possibly damaging Het
Slmo1 A T 18: 67,472,948 S42C probably benign Het
Smarca2 A G 19: 26,676,680 N755S possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfb2m G A 1: 179,546,103 P10L probably benign Het
Trim30c T C 7: 104,383,496 M252V probably benign Het
Ttll1 A G 15: 83,500,078 L116P probably damaging Het
Tubd1 C T 11: 86,549,422 H91Y possibly damaging Het
Vgll4 A G 6: 114,862,825 S175P probably damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Vmn2r80 C T 10: 79,194,316 Q659* probably null Het
Zfp382 A G 7: 30,134,415 D497G possibly damaging Het
Zfp41 A G 15: 75,618,535 E112G probably damaging Het
Zfyve26 A G 12: 79,260,831 S1754P probably damaging Het
Other mutations in Cpt1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Cpt1b APN 15 89420863 missense probably benign 0.01
IGL00497:Cpt1b APN 15 89422293 missense probably benign 0.22
IGL01142:Cpt1b APN 15 89418993 missense probably benign
IGL02329:Cpt1b APN 15 89423739 missense probably benign
IGL02740:Cpt1b APN 15 89424332 missense probably damaging 1.00
IGL03196:Cpt1b APN 15 89424395 missense probably benign
macellaio UTSW 15 89423654 critical splice donor site probably null
oleagenous UTSW 15 89425214 missense probably damaging 1.00
IGL02796:Cpt1b UTSW 15 89424802 missense probably benign 0.04
PIT4519001:Cpt1b UTSW 15 89418863 missense probably damaging 1.00
R0276:Cpt1b UTSW 15 89419959 missense probably benign 0.12
R0302:Cpt1b UTSW 15 89417870 missense probably benign
R0454:Cpt1b UTSW 15 89424393 missense possibly damaging 0.47
R1199:Cpt1b UTSW 15 89419010 missense probably benign 0.01
R1633:Cpt1b UTSW 15 89418815 missense probably damaging 0.98
R1674:Cpt1b UTSW 15 89422332 missense possibly damaging 0.64
R2087:Cpt1b UTSW 15 89422208 missense probably benign 0.07
R2178:Cpt1b UTSW 15 89419043 missense probably damaging 1.00
R2414:Cpt1b UTSW 15 89420080 splice site probably benign
R2507:Cpt1b UTSW 15 89419098 missense probably benign 0.08
R2883:Cpt1b UTSW 15 89417869 missense probably benign 0.00
R3432:Cpt1b UTSW 15 89423741 missense possibly damaging 0.85
R3783:Cpt1b UTSW 15 89425189 missense probably damaging 1.00
R4574:Cpt1b UTSW 15 89424044 splice site probably null
R4737:Cpt1b UTSW 15 89421406 missense probably benign 0.03
R5122:Cpt1b UTSW 15 89424023 missense probably benign 0.09
R5320:Cpt1b UTSW 15 89419274 missense probably benign 0.00
R5365:Cpt1b UTSW 15 89420107 missense possibly damaging 0.78
R5699:Cpt1b UTSW 15 89424273 missense probably benign 0.44
R5710:Cpt1b UTSW 15 89425206 missense probably damaging 1.00
R5873:Cpt1b UTSW 15 89420728 missense probably damaging 1.00
R5941:Cpt1b UTSW 15 89425214 missense probably damaging 1.00
R6163:Cpt1b UTSW 15 89424417 missense probably benign 0.15
R6197:Cpt1b UTSW 15 89424834 missense possibly damaging 0.77
R6323:Cpt1b UTSW 15 89419063 missense probably benign 0.10
R6486:Cpt1b UTSW 15 89420824 missense probably benign
R7571:Cpt1b UTSW 15 89421343 critical splice donor site probably null
R7648:Cpt1b UTSW 15 89421367 missense probably damaging 1.00
R7743:Cpt1b UTSW 15 89421404 missense probably benign 0.25
R7893:Cpt1b UTSW 15 89423654 critical splice donor site probably null
R8021:Cpt1b UTSW 15 89421426 missense probably benign 0.00
R8394:Cpt1b UTSW 15 89422287 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCAGAACACACGTTTGTC -3'
(R):5'- TTGTGCAGGCCATGATGAAG -3'

Sequencing Primer
(F):5'- GTTTGTCGTCTTTTCCTCATAAGAAC -3'
(R):5'- CCATGATGAAGGGGTCCCATAAG -3'
Posted On2020-07-13