Incidental Mutation 'R8207:Clec16a'
ID635981
Institutional Source Beutler Lab
Gene Symbol Clec16a
Ensembl Gene ENSMUSG00000068663
Gene NameC-type lectin domain family 16, member A
Synonyms4932416N17Rik, curt
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_177562.5, NM_001204229.1; MGI: 1921624

Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R8207 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location10545339-10744878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10627448 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 518 (N518S)
Ref Sequence ENSEMBL: ENSMUSP00000123189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038145] [ENSMUST00000066345] [ENSMUST00000115823] [ENSMUST00000115824] [ENSMUST00000115827] [ENSMUST00000115828] [ENSMUST00000155633]
Predicted Effect probably benign
Transcript: ENSMUST00000038145
AA Change: N534S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000040267
Gene: ENSMUSG00000068663
AA Change: N534S

DomainStartEndE-ValueType
Pfam:FPL 51 199 9.2e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
low complexity region 897 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066345
AA Change: N520S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000065423
Gene: ENSMUSG00000068663
AA Change: N520S

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115823
AA Change: N99S

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111489
Gene: ENSMUSG00000068663
AA Change: N99S

DomainStartEndE-ValueType
low complexity region 456 491 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115824
AA Change: N520S

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111490
Gene: ENSMUSG00000068663
AA Change: N520S

DomainStartEndE-ValueType
Pfam:FPL 51 198 5.9e-66 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115827
AA Change: N534S

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000111493
Gene: ENSMUSG00000068663
AA Change: N534S

DomainStartEndE-ValueType
Pfam:FPL 51 199 8.7e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115828
AA Change: N534S

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000111494
Gene: ENSMUSG00000068663
AA Change: N534S

DomainStartEndE-ValueType
Pfam:FPL 51 199 2.1e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155633
AA Change: N518S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000123189
Gene: ENSMUSG00000068663
AA Change: N518S

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 396 417 N/A INTRINSIC
low complexity region 875 922 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin domain containing family. Single nucleotide polymorphisms in introns of this gene have been associated with diabetes mellitus, multiple sclerosis and rheumatoid arthritis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation have a curved tail, small body size, squinting eyes, crooked digits that curve outward, and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T A 9: 92,351,008 F61L probably benign Het
Aen G A 7: 78,902,743 M150I possibly damaging Het
Arhgef11 A G 3: 87,698,775 N279S possibly damaging Het
Arid3a T C 10: 79,950,926 probably null Het
Casp8ap2 A G 4: 32,646,446 T1840A possibly damaging Het
Ccdc14 T A 16: 34,705,043 N235K possibly damaging Het
Cdh7 T C 1: 109,994,346 V56A probably damaging Het
Cog7 T C 7: 121,977,292 D137G possibly damaging Het
Cpt1b T C 15: 89,418,815 T649A probably damaging Het
Efcab8 C G 2: 153,789,225 L192V probably damaging Het
Farp2 A G 1: 93,621,243 R1024G probably benign Het
Fmo1 T A 1: 162,850,107 T147S probably benign Het
Galnt13 A C 2: 54,880,110 I305L probably benign Het
Guca2a A G 4: 119,637,754 N2D unknown Het
Iqcd C T 5: 120,602,449 R282W probably damaging Het
Lamc1 A C 1: 153,250,522 C475G probably damaging Het
Map3k5 AAAAGAAAAAGA AA 10: 20,110,866 probably null Het
Med13 A T 11: 86,303,549 D789E probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mn1 A G 5: 111,421,785 Y1207C probably damaging Het
Mroh2b A G 15: 4,938,410 D977G possibly damaging Het
Mrpl53 A T 6: 83,109,188 N26I probably damaging Het
Ogdh T G 11: 6,349,329 F743V probably benign Het
Olfr1424 A T 19: 12,058,858 M298K possibly damaging Het
Olfr732 C T 14: 50,281,579 V225I probably benign Het
Olfr788 A G 10: 129,473,084 T131A probably benign Het
Pmvk A G 3: 89,468,592 E174G probably benign Het
Pou6f2 T C 13: 18,239,573 N206D Het
Riok1 T A 13: 38,052,320 H347Q probably damaging Het
Ryr1 A G 7: 29,090,225 L1488P probably damaging Het
Shkbp1 A G 7: 27,352,684 V158A probably benign Het
Slc9c1 A G 16: 45,539,713 I43M possibly damaging Het
Slmo1 A T 18: 67,472,948 S42C probably benign Het
Smarca2 A G 19: 26,676,680 N755S possibly damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfb2m G A 1: 179,546,103 P10L probably benign Het
Trim30c T C 7: 104,383,496 M252V probably benign Het
Ttll1 A G 15: 83,500,078 L116P probably damaging Het
Tubd1 C T 11: 86,549,422 H91Y possibly damaging Het
Vgll4 A G 6: 114,862,825 S175P probably damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Vmn2r80 C T 10: 79,194,316 Q659* probably null Het
Zfp382 A G 7: 30,134,415 D497G possibly damaging Het
Zfp41 A G 15: 75,618,535 E112G probably damaging Het
Zfyve26 A G 12: 79,260,831 S1754P probably damaging Het
Other mutations in Clec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Clec16a APN 16 10595896 missense probably damaging 1.00
IGL00503:Clec16a APN 16 10694649 missense possibly damaging 0.53
IGL01622:Clec16a APN 16 10577910 missense possibly damaging 0.47
IGL01623:Clec16a APN 16 10577910 missense possibly damaging 0.47
IGL02008:Clec16a APN 16 10580960 missense probably damaging 1.00
IGL02082:Clec16a APN 16 10614568 missense probably damaging 1.00
IGL02468:Clec16a APN 16 10741878 missense probably benign 0.13
IGL02499:Clec16a APN 16 10694676 missense probably benign 0.25
IGL02671:Clec16a APN 16 10627381 missense probably benign 0.19
G5030:Clec16a UTSW 16 10571561 missense probably damaging 1.00
IGL03055:Clec16a UTSW 16 10741781 missense probably damaging 0.99
P0014:Clec16a UTSW 16 10560156 splice site probably benign
R0183:Clec16a UTSW 16 10560022 missense probably damaging 1.00
R0268:Clec16a UTSW 16 10644828 nonsense probably null
R0512:Clec16a UTSW 16 10614580 missense probably damaging 1.00
R0556:Clec16a UTSW 16 10638785 critical splice acceptor site probably null
R0944:Clec16a UTSW 16 10688646 splice site probably benign
R1456:Clec16a UTSW 16 10691555 missense probably damaging 1.00
R1497:Clec16a UTSW 16 10635259 missense probably damaging 1.00
R1580:Clec16a UTSW 16 10595898 missense probably damaging 1.00
R1933:Clec16a UTSW 16 10688539 missense probably damaging 0.99
R2075:Clec16a UTSW 16 10741616 missense probably benign 0.09
R2269:Clec16a UTSW 16 10644786 missense probably damaging 1.00
R2504:Clec16a UTSW 16 10559687 intron probably benign
R3011:Clec16a UTSW 16 10611111 missense probably benign 0.01
R4331:Clec16a UTSW 16 10571669 missense probably benign
R4616:Clec16a UTSW 16 10644883 critical splice donor site probably null
R4775:Clec16a UTSW 16 10638914 missense probably damaging 1.00
R4969:Clec16a UTSW 16 10568511 missense probably damaging 1.00
R5053:Clec16a UTSW 16 10576597 missense probably damaging 1.00
R5170:Clec16a UTSW 16 10741791 missense probably benign
R5329:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5331:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5332:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5417:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5419:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5420:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5457:Clec16a UTSW 16 10545532 splice site probably null
R5623:Clec16a UTSW 16 10611121 missense probably benign 0.07
R6057:Clec16a UTSW 16 10630087 missense probably damaging 1.00
R6184:Clec16a UTSW 16 10572928 splice site probably null
R6235:Clec16a UTSW 16 10694635 missense probably damaging 1.00
R6260:Clec16a UTSW 16 10694848 intron probably benign
R6292:Clec16a UTSW 16 10560151 critical splice donor site probably null
R6318:Clec16a UTSW 16 10630788 missense probably damaging 1.00
R6894:Clec16a UTSW 16 10644854 missense probably damaging 1.00
R7340:Clec16a UTSW 16 10580963 missense probably null 0.21
R7432:Clec16a UTSW 16 10688555 missense possibly damaging 0.62
R7453:Clec16a UTSW 16 10644822 missense probably damaging 1.00
R7536:Clec16a UTSW 16 10638844 missense possibly damaging 0.90
R8207:Clec16a UTSW 16 10694710 missense probably damaging 1.00
R8423:Clec16a UTSW 16 10576663 missense probably benign 0.04
R8447:Clec16a UTSW 16 10741623 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCTCAGTGTACACAGAACCC -3'
(R):5'- CAGAAGGCAGATGTTGGTGC -3'

Sequencing Primer
(F):5'- GCCATGCCAGATGTCACTG -3'
(R):5'- ATGTTGGTGCCTAGGGGAAAG -3'
Posted On2020-07-13