Incidental Mutation 'R8208:Ndufaf1'
ID635996
Institutional Source Beutler Lab
Gene Symbol Ndufaf1
Ensembl Gene ENSMUSG00000027305
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1
SynonymsCGI-65, 2410001M24Rik, CIA30
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R8208 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location119655446-119662827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119660346 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 80 (T80A)
Ref Sequence ENSEMBL: ENSMUSP00000028768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028768] [ENSMUST00000110801] [ENSMUST00000110802]
Predicted Effect probably benign
Transcript: ENSMUST00000028768
AA Change: T80A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000028768
Gene: ENSMUSG00000027305
AA Change: T80A

DomainStartEndE-ValueType
Pfam:CIA30 128 301 3e-51 PFAM
Pfam:CBM_11 193 315 1.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110801
AA Change: T78A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000106425
Gene: ENSMUSG00000027305
AA Change: T78A

DomainStartEndE-ValueType
Pfam:CIA30 126 299 1.1e-47 PFAM
Pfam:CBM_11 127 312 1.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110802
AA Change: T78A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000106426
Gene: ENSMUSG00000027305
AA Change: T78A

DomainStartEndE-ValueType
Pfam:CIA30 126 299 1.1e-47 PFAM
Pfam:CBM_11 127 312 1.3e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a complex I assembly factor protein. Complex I (NADH-ubiquinone oxidoreductase) catalyzes the transfer of electrons from NADH to ubiquinone (coenzyme Q) in the first step of the mitochondrial respiratory chain, resulting in the translocation of protons across the inner mitochondrial membrane. The encoded protein is required for assembly of complex I, and mutations in this gene are a cause of mitochondrial complex I deficiency. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 G A 6: 58,665,242 V172I possibly damaging Het
Agbl1 T A 7: 76,720,168 C924S unknown Het
Arhgap11a T C 2: 113,842,939 S100G probably benign Het
Colec10 C G 15: 54,462,300 H175Q possibly damaging Het
Cyp46a1 A T 12: 108,351,912 probably null Het
Dennd4b T A 3: 90,270,971 I501N possibly damaging Het
Dnah2 A G 11: 69,520,852 F315L probably benign Het
Emilin1 A G 5: 30,917,516 E367G probably damaging Het
Folh1 A T 7: 86,725,917 H620Q probably damaging Het
Galnt10 A T 11: 57,645,572 E5V possibly damaging Het
Gmcl1 A G 6: 86,721,399 V172A probably damaging Het
Greb1l T C 18: 10,510,703 L599P probably damaging Het
Hcn2 T A 10: 79,730,944 M485K possibly damaging Het
Hirip3 G T 7: 126,864,423 C494F probably damaging Het
Hsfy2 A G 1: 56,637,151 F76L probably benign Het
Lamc3 A G 2: 31,887,414 H24R possibly damaging Het
Laptm4b G A 15: 34,277,445 S174N probably damaging Het
Lgals8 A G 13: 12,453,374 Y125H probably damaging Het
Mapk14 A T 17: 28,724,833 Y132F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mxd4 A T 5: 34,177,726 I115N probably benign Het
Olfr1115 A G 2: 87,252,663 K242R probably benign Het
Olfr195 C A 16: 59,149,019 H56Q probably benign Het
Olfr683 T A 7: 105,143,418 I298F probably damaging Het
Olfr745 T C 14: 50,642,631 F117L probably benign Het
Pcf11 G T 7: 92,649,523 N1268K probably damaging Het
Plcl2 T C 17: 50,608,315 V784A probably damaging Het
Ptp4a2 C T 4: 129,842,692 T40I probably benign Het
Rab2b C T 14: 52,264,767 A159T possibly damaging Het
Sec61a2 G T 2: 5,876,998 T207K probably benign Het
Serpina5 A G 12: 104,105,273 I380V probably benign Het
Slc26a2 C T 18: 61,198,734 V542M probably damaging Het
Snd1 C T 6: 28,526,055 P144L possibly damaging Het
Spop C T 11: 95,491,824 R370C probably damaging Het
Sptbn1 T C 11: 30,124,972 D1300G probably damaging Het
Sptbn5 T A 2: 120,047,845 K891* noncoding transcript Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tnrc6b G A 15: 80,858,700 E45K possibly damaging Het
Tpst1 A G 5: 130,101,910 I74V probably benign Het
Ttn T C 2: 76,725,848 H30271R probably damaging Het
Ush2a G T 1: 188,874,793 A3962S possibly damaging Het
Vmn1r200 G A 13: 22,395,300 R91H probably damaging Het
Vmn2r22 T A 6: 123,637,485 N382I probably damaging Het
Vmn2r53 A G 7: 12,601,395 S113P probably damaging Het
Zfp335 C A 2: 164,893,616 probably null Het
Other mutations in Ndufaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Ndufaf1 APN 2 119660469 missense probably damaging 1.00
IGL01871:Ndufaf1 APN 2 119658287 nonsense probably null
IGL02452:Ndufaf1 APN 2 119656426 missense probably damaging 1.00
IGL03087:Ndufaf1 APN 2 119655799 splice site probably benign
R1211:Ndufaf1 UTSW 2 119655675 missense probably damaging 1.00
R2420:Ndufaf1 UTSW 2 119655737 missense probably damaging 1.00
R2421:Ndufaf1 UTSW 2 119655737 missense probably damaging 1.00
R2422:Ndufaf1 UTSW 2 119655737 missense probably damaging 1.00
R3824:Ndufaf1 UTSW 2 119660271 missense probably benign 0.30
R4942:Ndufaf1 UTSW 2 119660066 missense possibly damaging 0.83
R5382:Ndufaf1 UTSW 2 119660412 missense possibly damaging 0.75
R5460:Ndufaf1 UTSW 2 119660477 missense probably benign 0.02
R5732:Ndufaf1 UTSW 2 119660040 nonsense probably null
R5777:Ndufaf1 UTSW 2 119660482 nonsense probably null
R5919:Ndufaf1 UTSW 2 119660228 missense possibly damaging 0.51
R6371:Ndufaf1 UTSW 2 119660053 missense probably damaging 1.00
R6378:Ndufaf1 UTSW 2 119655726 missense probably damaging 0.99
R7202:Ndufaf1 UTSW 2 119658426 missense probably benign 0.39
R7224:Ndufaf1 UTSW 2 119658396 missense probably damaging 1.00
R7847:Ndufaf1 UTSW 2 119660053 missense probably damaging 1.00
R8319:Ndufaf1 UTSW 2 119660087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAAGCAGGGCACTTCGGTTG -3'
(R):5'- GGGCTGCATTACCTCCATTTG -3'

Sequencing Primer
(F):5'- ACCTCCAATTGTCTTATCAGAAGTC -3'
(R):5'- ACCTCCATTTGTGGGTAGTCACTG -3'
Posted On2020-07-13