Incidental Mutation 'R8208:Vmn2r53'
ID 636008
Institutional Source Beutler Lab
Gene Symbol Vmn2r53
Ensembl Gene ENSMUSG00000096002
Gene Name vomeronasal 2, receptor 53
Synonyms EG637908
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock # R8208 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 12581470-12606544 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12601395 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 113 (S113P)
Ref Sequence ENSEMBL: ENSMUSP00000126979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170412]
AlphaFold A0A3B2W4A7
Predicted Effect probably damaging
Transcript: ENSMUST00000170412
AA Change: S113P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126979
Gene: ENSMUSG00000096002
AA Change: S113P

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.6e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 3.1e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 G A 6: 58,665,242 V172I possibly damaging Het
Agbl1 T A 7: 76,720,168 C924S unknown Het
Arhgap11a T C 2: 113,842,939 S100G probably benign Het
Chd9 T A 8: 91,037,263 probably null Het
Col1a2 T A 6: 4,515,260 probably null Het
Colec10 C G 15: 54,462,300 H175Q possibly damaging Het
Cyp46a1 A T 12: 108,351,912 probably null Het
Dennd4b T A 3: 90,270,971 I501N possibly damaging Het
Dnah2 A G 11: 69,520,852 F315L probably benign Het
Emilin1 A G 5: 30,917,516 E367G probably damaging Het
Folh1 A T 7: 86,725,917 H620Q probably damaging Het
Galnt10 A T 11: 57,645,572 E5V possibly damaging Het
Gmcl1 A G 6: 86,721,399 V172A probably damaging Het
Greb1l T C 18: 10,510,703 L599P probably damaging Het
Hcn2 T A 10: 79,730,944 M485K possibly damaging Het
Hirip3 G T 7: 126,864,423 C494F probably damaging Het
Hsfy2 A G 1: 56,637,151 F76L probably benign Het
Lamc3 A G 2: 31,887,414 H24R possibly damaging Het
Laptm4b G A 15: 34,277,445 S174N probably damaging Het
Lgals8 A G 13: 12,453,374 Y125H probably damaging Het
Mapk14 A T 17: 28,724,833 Y132F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mxd4 A T 5: 34,177,726 I115N probably benign Het
Ndufaf1 T C 2: 119,660,346 T80A probably benign Het
Olfr1115 A G 2: 87,252,663 K242R probably benign Het
Olfr195 C A 16: 59,149,019 H56Q probably benign Het
Olfr683 T A 7: 105,143,418 I298F probably damaging Het
Olfr745 T C 14: 50,642,631 F117L probably benign Het
Pcf11 G T 7: 92,649,523 N1268K probably damaging Het
Plcl2 T C 17: 50,608,315 V784A probably damaging Het
Ptp4a2 C T 4: 129,842,692 T40I probably benign Het
Rab2b C T 14: 52,264,767 A159T possibly damaging Het
Sec61a2 G T 2: 5,876,998 T207K probably benign Het
Serpina5 A G 12: 104,105,273 I380V probably benign Het
Slc26a2 C T 18: 61,198,734 V542M probably damaging Het
Snd1 C T 6: 28,526,055 P144L possibly damaging Het
Spop C T 11: 95,491,824 R370C probably damaging Het
Sptbn1 T C 11: 30,124,972 D1300G probably damaging Het
Sptbn5 T A 2: 120,047,845 K891* noncoding transcript Het
Tnrc6b G A 15: 80,858,700 E45K possibly damaging Het
Tpst1 A G 5: 130,101,910 I74V probably benign Het
Ttn T C 2: 76,725,848 H30271R probably damaging Het
Ush2a G T 1: 188,874,793 A3962S possibly damaging Het
Vmn1r200 G A 13: 22,395,300 R91H probably damaging Het
Vmn2r22 T A 6: 123,637,485 N382I probably damaging Het
Zfp335 C A 2: 164,893,616 probably null Het
Other mutations in Vmn2r53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r53 APN 7 12600908 missense possibly damaging 0.70
IGL01997:Vmn2r53 APN 7 12582446 missense possibly damaging 0.54
IGL02442:Vmn2r53 APN 7 12581729 missense probably damaging 1.00
IGL02449:Vmn2r53 APN 7 12582361 missense probably damaging 1.00
IGL02589:Vmn2r53 APN 7 12581945 missense possibly damaging 0.93
IGL02986:Vmn2r53 APN 7 12581466 unclassified probably benign
IGL03064:Vmn2r53 APN 7 12601010 missense possibly damaging 0.89
IGL03093:Vmn2r53 APN 7 12600864 missense probably benign 0.03
IGL03244:Vmn2r53 APN 7 12606508 missense probably damaging 1.00
IGL03252:Vmn2r53 APN 7 12606391 missense probably damaging 1.00
IGL03264:Vmn2r53 APN 7 12581892 missense possibly damaging 0.95
IGL03293:Vmn2r53 APN 7 12598422 missense probably benign 0.34
R0109:Vmn2r53 UTSW 7 12582066 missense probably damaging 1.00
R0453:Vmn2r53 UTSW 7 12582411 missense probably damaging 1.00
R0735:Vmn2r53 UTSW 7 12581780 missense probably benign
R0881:Vmn2r53 UTSW 7 12600932 missense probably benign 0.01
R0894:Vmn2r53 UTSW 7 12601214 missense probably benign 0.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0974:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0990:Vmn2r53 UTSW 7 12581502 missense probably benign
R1102:Vmn2r53 UTSW 7 12598483 missense possibly damaging 0.94
R1141:Vmn2r53 UTSW 7 12600746 missense possibly damaging 0.54
R1263:Vmn2r53 UTSW 7 12581606 missense probably benign 0.41
R1343:Vmn2r53 UTSW 7 12584774 missense probably benign 0.08
R1750:Vmn2r53 UTSW 7 12581705 missense probably damaging 1.00
R1836:Vmn2r53 UTSW 7 12600885 missense probably damaging 1.00
R2035:Vmn2r53 UTSW 7 12598511 missense possibly damaging 0.76
R2202:Vmn2r53 UTSW 7 12601439 missense probably damaging 1.00
R3707:Vmn2r53 UTSW 7 12582054 missense possibly damaging 0.95
R4372:Vmn2r53 UTSW 7 12581729 missense probably damaging 0.98
R4615:Vmn2r53 UTSW 7 12582302 missense probably damaging 1.00
R4655:Vmn2r53 UTSW 7 12582005 missense possibly damaging 0.83
R4663:Vmn2r53 UTSW 7 12600974 missense probably benign 0.21
R4708:Vmn2r53 UTSW 7 12601202 missense probably benign
R4710:Vmn2r53 UTSW 7 12601202 missense probably benign
R4774:Vmn2r53 UTSW 7 12600765 nonsense probably null
R4859:Vmn2r53 UTSW 7 12601403 missense probably damaging 1.00
R5061:Vmn2r53 UTSW 7 12581814 missense probably benign 0.01
R5561:Vmn2r53 UTSW 7 12601420 missense probably damaging 1.00
R5729:Vmn2r53 UTSW 7 12600806 missense probably damaging 1.00
R6004:Vmn2r53 UTSW 7 12582401 missense probably benign 0.12
R6083:Vmn2r53 UTSW 7 12581881 missense probably benign
R6312:Vmn2r53 UTSW 7 12598639 critical splice acceptor site probably null
R6700:Vmn2r53 UTSW 7 12581706 missense probably damaging 0.96
R6783:Vmn2r53 UTSW 7 12601433 missense probably damaging 1.00
R6852:Vmn2r53 UTSW 7 12606514 missense probably damaging 0.99
R6889:Vmn2r53 UTSW 7 12601142 missense probably benign 0.10
R6940:Vmn2r53 UTSW 7 12582416 missense probably benign 0.19
R7100:Vmn2r53 UTSW 7 12581586 nonsense probably null
R7174:Vmn2r53 UTSW 7 12581701 missense probably benign 0.01
R7213:Vmn2r53 UTSW 7 12601056 missense probably benign 0.17
R7276:Vmn2r53 UTSW 7 12606432 missense probably damaging 0.99
R7515:Vmn2r53 UTSW 7 12581919 missense probably benign 0.05
R7678:Vmn2r53 UTSW 7 12598498 missense probably benign 0.04
R7714:Vmn2r53 UTSW 7 12606491 missense probably damaging 1.00
R7843:Vmn2r53 UTSW 7 12582099 missense probably damaging 1.00
R8211:Vmn2r53 UTSW 7 12581916 missense probably benign 0.01
R8478:Vmn2r53 UTSW 7 12606354 missense probably benign 0.01
R8853:Vmn2r53 UTSW 7 12581810 missense probably damaging 1.00
R8924:Vmn2r53 UTSW 7 12600825 missense probably benign 0.17
R8963:Vmn2r53 UTSW 7 12581999 missense probably damaging 1.00
R9042:Vmn2r53 UTSW 7 12581508 missense probably benign
R9076:Vmn2r53 UTSW 7 12606304 missense probably damaging 1.00
R9407:Vmn2r53 UTSW 7 12601197 missense probably damaging 0.99
R9690:Vmn2r53 UTSW 7 12581985 missense probably damaging 1.00
Z1176:Vmn2r53 UTSW 7 12601304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAATGCACACACCAGCTGG -3'
(R):5'- AGTCCTTTCAGGCGAATCTTTATG -3'

Sequencing Primer
(F):5'- CAGCTGGGGTCAACATCTGTG -3'
(R):5'- ACTTGGGTCCTCTACAAGATGAGC -3'
Posted On 2020-07-13