Incidental Mutation 'R8208:Olfr683'
ID636012
Institutional Source Beutler Lab
Gene Symbol Olfr683
Ensembl Gene ENSMUSG00000044120
Gene Nameolfactory receptor 683
SynonymsGA_x6K02T2PBJ9-7773007-7772066, MOR40-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8208 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105140839-105147012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105143418 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 298 (I298F)
Ref Sequence ENSEMBL: ENSMUSP00000060527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061284] [ENSMUST00000209879]
Predicted Effect probably damaging
Transcript: ENSMUST00000061284
AA Change: I298F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060527
Gene: ENSMUSG00000044120
AA Change: I298F

DomainStartEndE-ValueType
Pfam:7tm_4 40 318 8.5e-73 PFAM
Pfam:7TM_GPCR_Srsx 44 315 3.5e-8 PFAM
Pfam:7tm_1 50 300 1.3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209879
AA Change: I292F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 G A 6: 58,665,242 V172I possibly damaging Het
Agbl1 T A 7: 76,720,168 C924S unknown Het
Arhgap11a T C 2: 113,842,939 S100G probably benign Het
Chd9 T A 8: 91,037,263 probably null Het
Col1a2 T A 6: 4,515,260 probably null Het
Colec10 C G 15: 54,462,300 H175Q possibly damaging Het
Cyp46a1 A T 12: 108,351,912 probably null Het
Dennd4b T A 3: 90,270,971 I501N possibly damaging Het
Dnah2 A G 11: 69,520,852 F315L probably benign Het
Emilin1 A G 5: 30,917,516 E367G probably damaging Het
Folh1 A T 7: 86,725,917 H620Q probably damaging Het
Galnt10 A T 11: 57,645,572 E5V possibly damaging Het
Gmcl1 A G 6: 86,721,399 V172A probably damaging Het
Greb1l T C 18: 10,510,703 L599P probably damaging Het
Hcn2 T A 10: 79,730,944 M485K possibly damaging Het
Hirip3 G T 7: 126,864,423 C494F probably damaging Het
Hsfy2 A G 1: 56,637,151 F76L probably benign Het
Lamc3 A G 2: 31,887,414 H24R possibly damaging Het
Laptm4b G A 15: 34,277,445 S174N probably damaging Het
Lgals8 A G 13: 12,453,374 Y125H probably damaging Het
Mapk14 A T 17: 28,724,833 Y132F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mxd4 A T 5: 34,177,726 I115N probably benign Het
Ndufaf1 T C 2: 119,660,346 T80A probably benign Het
Olfr1115 A G 2: 87,252,663 K242R probably benign Het
Olfr195 C A 16: 59,149,019 H56Q probably benign Het
Olfr745 T C 14: 50,642,631 F117L probably benign Het
Pcf11 G T 7: 92,649,523 N1268K probably damaging Het
Plcl2 T C 17: 50,608,315 V784A probably damaging Het
Ptp4a2 C T 4: 129,842,692 T40I probably benign Het
Rab2b C T 14: 52,264,767 A159T possibly damaging Het
Sec61a2 G T 2: 5,876,998 T207K probably benign Het
Serpina5 A G 12: 104,105,273 I380V probably benign Het
Slc26a2 C T 18: 61,198,734 V542M probably damaging Het
Snd1 C T 6: 28,526,055 P144L possibly damaging Het
Spop C T 11: 95,491,824 R370C probably damaging Het
Sptbn1 T C 11: 30,124,972 D1300G probably damaging Het
Sptbn5 T A 2: 120,047,845 K891* noncoding transcript Het
Tnrc6b G A 15: 80,858,700 E45K possibly damaging Het
Tpst1 A G 5: 130,101,910 I74V probably benign Het
Ttn T C 2: 76,725,848 H30271R probably damaging Het
Ush2a G T 1: 188,874,793 A3962S possibly damaging Het
Vmn1r200 G A 13: 22,395,300 R91H probably damaging Het
Vmn2r22 T A 6: 123,637,485 N382I probably damaging Het
Vmn2r53 A G 7: 12,601,395 S113P probably damaging Het
Zfp335 C A 2: 164,893,616 probably null Het
Other mutations in Olfr683
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Olfr683 APN 7 105143604 missense possibly damaging 0.48
IGL01984:Olfr683 APN 7 105143716 missense probably benign 0.00
IGL02456:Olfr683 APN 7 105143759 missense probably damaging 0.99
IGL03242:Olfr683 APN 7 105144266 missense probably benign 0.00
R0234:Olfr683 UTSW 7 105144074 missense probably damaging 1.00
R0234:Olfr683 UTSW 7 105144074 missense probably damaging 1.00
R1282:Olfr683 UTSW 7 105143652 missense probably benign 0.01
R1485:Olfr683 UTSW 7 105143681 missense probably benign 0.00
R1653:Olfr683 UTSW 7 105143870 missense possibly damaging 0.80
R2130:Olfr683 UTSW 7 105143550 missense probably benign 0.03
R2355:Olfr683 UTSW 7 105143813 missense probably benign 0.11
R4491:Olfr683 UTSW 7 105143776 nonsense probably null
R4826:Olfr683 UTSW 7 105143968 missense probably damaging 0.99
R4980:Olfr683 UTSW 7 105144224 missense probably benign
R5934:Olfr683 UTSW 7 105143660 missense probably benign 0.12
R6354:Olfr683 UTSW 7 105143708 missense probably benign 0.04
R7371:Olfr683 UTSW 7 105143879 missense possibly damaging 0.82
R7463:Olfr683 UTSW 7 105143937 missense probably benign 0.00
R7753:Olfr683 UTSW 7 105143800 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CCAGGTCCCATTTCAACATGATTAC -3'
(R):5'- TGAAGGCTGTGCTCAGGATC -3'

Sequencing Primer
(F):5'- CCATTTCAACATGATTACTTAACACC -3'
(R):5'- GCTGTGCTCAGGATCAAAGC -3'
Posted On2020-07-13