Incidental Mutation 'R8208:Laptm4b'
ID 636027
Institutional Source Beutler Lab
Gene Symbol Laptm4b
Ensembl Gene ENSMUSG00000022257
Gene Name lysosomal-associated protein transmembrane 4B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock # R8208 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 34238028-34284302 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34277445 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 174 (S174N)
Ref Sequence ENSEMBL: ENSMUSP00000022867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022867]
AlphaFold Q91XQ6
Predicted Effect probably damaging
Transcript: ENSMUST00000022867
AA Change: S174N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022867
Gene: ENSMUSG00000022257
AA Change: S174N

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
Pfam:Mtp 139 226 6.4e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 G A 6: 58,665,242 V172I possibly damaging Het
Agbl1 T A 7: 76,720,168 C924S unknown Het
Arhgap11a T C 2: 113,842,939 S100G probably benign Het
Chd9 T A 8: 91,037,263 probably null Het
Col1a2 T A 6: 4,515,260 probably null Het
Colec10 C G 15: 54,462,300 H175Q possibly damaging Het
Cyp46a1 A T 12: 108,351,912 probably null Het
Dennd4b T A 3: 90,270,971 I501N possibly damaging Het
Dnah2 A G 11: 69,520,852 F315L probably benign Het
Emilin1 A G 5: 30,917,516 E367G probably damaging Het
Folh1 A T 7: 86,725,917 H620Q probably damaging Het
Galnt10 A T 11: 57,645,572 E5V possibly damaging Het
Gmcl1 A G 6: 86,721,399 V172A probably damaging Het
Greb1l T C 18: 10,510,703 L599P probably damaging Het
Hcn2 T A 10: 79,730,944 M485K possibly damaging Het
Hirip3 G T 7: 126,864,423 C494F probably damaging Het
Hsfy2 A G 1: 56,637,151 F76L probably benign Het
Lamc3 A G 2: 31,887,414 H24R possibly damaging Het
Lgals8 A G 13: 12,453,374 Y125H probably damaging Het
Mapk14 A T 17: 28,724,833 Y132F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mxd4 A T 5: 34,177,726 I115N probably benign Het
Ndufaf1 T C 2: 119,660,346 T80A probably benign Het
Olfr1115 A G 2: 87,252,663 K242R probably benign Het
Olfr195 C A 16: 59,149,019 H56Q probably benign Het
Olfr683 T A 7: 105,143,418 I298F probably damaging Het
Olfr745 T C 14: 50,642,631 F117L probably benign Het
Pcf11 G T 7: 92,649,523 N1268K probably damaging Het
Plcl2 T C 17: 50,608,315 V784A probably damaging Het
Ptp4a2 C T 4: 129,842,692 T40I probably benign Het
Rab2b C T 14: 52,264,767 A159T possibly damaging Het
Sec61a2 G T 2: 5,876,998 T207K probably benign Het
Serpina5 A G 12: 104,105,273 I380V probably benign Het
Slc26a2 C T 18: 61,198,734 V542M probably damaging Het
Snd1 C T 6: 28,526,055 P144L possibly damaging Het
Spop C T 11: 95,491,824 R370C probably damaging Het
Sptbn1 T C 11: 30,124,972 D1300G probably damaging Het
Sptbn5 T A 2: 120,047,845 K891* noncoding transcript Het
Tnrc6b G A 15: 80,858,700 E45K possibly damaging Het
Tpst1 A G 5: 130,101,910 I74V probably benign Het
Ttn T C 2: 76,725,848 H30271R probably damaging Het
Ush2a G T 1: 188,874,793 A3962S possibly damaging Het
Vmn1r200 G A 13: 22,395,300 R91H probably damaging Het
Vmn2r22 T A 6: 123,637,485 N382I probably damaging Het
Vmn2r53 A G 7: 12,601,395 S113P probably damaging Het
Zfp335 C A 2: 164,893,616 probably null Het
Other mutations in Laptm4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Laptm4b APN 15 34258742 missense probably benign 0.01
IGL02638:Laptm4b APN 15 34277484 missense probably benign 0.06
R0609:Laptm4b UTSW 15 34258689 missense probably damaging 1.00
R2140:Laptm4b UTSW 15 34238332 missense probably benign 0.10
R2142:Laptm4b UTSW 15 34238332 missense probably benign 0.10
R5907:Laptm4b UTSW 15 34258684 missense possibly damaging 0.59
R6275:Laptm4b UTSW 15 34283327 missense probably benign 0.12
R7749:Laptm4b UTSW 15 34276200 missense probably benign 0.21
R8711:Laptm4b UTSW 15 34277502 missense probably damaging 1.00
R8755:Laptm4b UTSW 15 34273274 missense probably damaging 1.00
R8770:Laptm4b UTSW 15 34258697 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTGCAAACTTTATATGCCCCAG -3'
(R):5'- ACATGTCTCAAATCCAGCAGG -3'

Sequencing Primer
(F):5'- ACTTTATATGCCCCAGTACAGG -3'
(R):5'- CCAGCAGGACGTGGCAAAC -3'
Posted On 2020-07-13