Incidental Mutation 'R0723:Cadps2'
ID 63603
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene Name Ca2+-dependent activator protein for secretion 2
Synonyms Caps2, A230044C21Rik, cpd2
MMRRC Submission 038905-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0723 (G1)
Quality Score 162
Status Validated
Chromosome 6
Chromosomal Location 23262772-23839420 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23287697 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1161 (V1161A)
Ref Sequence ENSEMBL: ENSMUSP00000111015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000018122
AA Change: V1201A

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: V1201A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000069074
AA Change: V1194A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: V1194A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115358
AA Change: V1161A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: V1161A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115361
AA Change: V1156A

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: V1156A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125350
AA Change: V796A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: V796A

DomainStartEndE-ValueType
C2 14 112 1.51e-1 SMART
PH 137 241 2.94e-11 SMART
DUF1041 446 537 1.9e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142913
AA Change: V1172A

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: V1172A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163871
AA Change: V1201A

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: V1201A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166458
AA Change: V1172A

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: V1172A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152131
Meta Mutation Damage Score 0.2310 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,642,480 (GRCm39) T141S probably benign Het
Acbd5 T G 2: 22,959,608 (GRCm39) V54G probably damaging Het
Acin1 A T 14: 54,902,908 (GRCm39) S255T probably damaging Het
Adcy2 A G 13: 69,147,248 (GRCm39) L56P probably damaging Het
Akap6 G T 12: 53,188,685 (GRCm39) C2033F probably damaging Het
Ano5 A G 7: 51,237,506 (GRCm39) I777V probably benign Het
Arhgef28 A G 13: 98,075,987 (GRCm39) V1349A probably benign Het
Atosa G A 9: 74,916,733 (GRCm39) G444E probably damaging Het
Bank1 T C 3: 135,760,164 (GRCm39) probably null Het
C2cd5 T C 6: 142,987,281 (GRCm39) probably benign Het
Car8 A T 4: 8,169,703 (GRCm39) D268E probably benign Het
Ciao3 G A 17: 26,000,795 (GRCm39) V406M probably damaging Het
Ckap5 T A 2: 91,385,676 (GRCm39) S175T probably damaging Het
Clk4 T A 11: 51,166,320 (GRCm39) Y67* probably null Het
Copg2 T C 6: 30,792,917 (GRCm39) I473V possibly damaging Het
Cstdc1 T C 2: 148,625,282 (GRCm39) I72T probably damaging Het
Cyp2s1 C T 7: 25,508,973 (GRCm39) V43I probably benign Het
Ddx54 A G 5: 120,761,703 (GRCm39) D493G probably benign Het
Efemp2 T C 19: 5,530,078 (GRCm39) S140P probably damaging Het
Fat1 C A 8: 45,479,786 (GRCm39) T2944K probably damaging Het
Fgfr1 T A 8: 26,047,784 (GRCm39) D43E probably damaging Het
Fry G A 5: 150,419,825 (GRCm39) A996T probably damaging Het
Fyb2 G A 4: 104,873,063 (GRCm39) V784I probably benign Het
Gm6507 T A 6: 89,162,144 (GRCm39) noncoding transcript Het
Gm7964 T C 7: 83,405,374 (GRCm39) noncoding transcript Het
Gucy2c T C 6: 136,704,799 (GRCm39) probably null Het
Hdac10 A T 15: 89,010,621 (GRCm39) L259Q probably damaging Het
Hoxd9 A T 2: 74,529,172 (GRCm39) D258V probably damaging Het
Hs3st3b1 T C 11: 63,812,401 (GRCm39) T105A probably benign Het
Hsd17b7 A G 1: 169,783,595 (GRCm39) L271P probably damaging Het
Ifnlr1 T A 4: 135,428,524 (GRCm39) probably benign Het
Kif22 A T 7: 126,633,078 (GRCm39) M121K probably damaging Het
Kl G A 5: 150,876,566 (GRCm39) D129N probably damaging Het
Mettl13 A T 1: 162,361,999 (GRCm39) I648N probably damaging Het
Mlh1 C T 9: 111,100,540 (GRCm39) R18H probably damaging Het
Mtmr14 T C 6: 113,247,473 (GRCm39) probably benign Het
Myo15a C A 11: 60,369,803 (GRCm39) N854K possibly damaging Het
Myo1h T C 5: 114,457,741 (GRCm39) I84T probably benign Het
Myo9a A T 9: 59,778,383 (GRCm39) S1380C probably benign Het
Myof A G 19: 37,969,708 (GRCm39) V318A probably damaging Het
N4bp2l2 A G 5: 150,585,897 (GRCm39) S28P probably damaging Het
Nbr1 C T 11: 101,467,145 (GRCm39) Q570* probably null Het
Nhp2 C T 11: 51,510,750 (GRCm39) Q36* probably null Het
Or1e17 T G 11: 73,831,096 (GRCm39) V8G probably benign Het
Or8b37 G T 9: 37,959,123 (GRCm39) V202L probably benign Het
Poc1b T A 10: 98,965,457 (GRCm39) W129R probably damaging Het
Potegl T C 2: 23,146,936 (GRCm39) probably benign Het
Rapgef2 C T 3: 78,986,481 (GRCm39) E1018K probably benign Het
Rgs12 T C 5: 35,181,710 (GRCm39) probably benign Het
Rufy2 G A 10: 62,833,873 (GRCm39) V280I probably benign Het
Snx2 A G 18: 53,343,444 (GRCm39) I281V probably benign Het
Spag5 C A 11: 78,210,410 (GRCm39) probably benign Het
Spata31g1 T A 4: 42,971,691 (GRCm39) N341K probably damaging Het
Stxbp5 A T 10: 9,644,617 (GRCm39) I961N probably damaging Het
Tet2 T C 3: 133,173,045 (GRCm39) E1739G probably benign Het
Tmod2 A G 9: 75,502,337 (GRCm39) F50S possibly damaging Het
Tnfsf13b T G 8: 10,057,166 (GRCm39) probably null Het
Ttn T C 2: 76,616,679 (GRCm39) K16525E possibly damaging Het
Txnrd2 T C 16: 18,259,629 (GRCm39) probably benign Het
Ubr1 A T 2: 120,711,582 (GRCm39) Y1437* probably null Het
Vwf C A 6: 125,543,225 (GRCm39) D170E probably benign Het
Wdr95 C G 5: 149,497,513 (GRCm39) I230M probably damaging Het
Xirp2 C T 2: 67,342,559 (GRCm39) S1600F probably damaging Het
Zfp12 A G 5: 143,230,638 (GRCm39) K322E probably damaging Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23,496,873 (GRCm39) missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23,321,699 (GRCm39) splice site probably benign
IGL01317:Cadps2 APN 6 23,314,172 (GRCm39) missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23,587,440 (GRCm39) missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23,263,672 (GRCm39) missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23,587,461 (GRCm39) missense probably benign 0.19
IGL01674:Cadps2 APN 6 23,355,851 (GRCm39) missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23,382,904 (GRCm39) missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23,427,274 (GRCm39) missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23,427,309 (GRCm39) missense probably benign 0.01
IGL02200:Cadps2 APN 6 23,385,527 (GRCm39) missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23,287,731 (GRCm39) missense probably benign 0.11
IGL02680:Cadps2 APN 6 23,838,895 (GRCm39) missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23,321,706 (GRCm39) missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23,496,808 (GRCm39) missense probably benign 0.08
IGL03061:Cadps2 APN 6 23,287,659 (GRCm39) splice site probably null
IGL03233:Cadps2 APN 6 23,263,600 (GRCm39) missense probably benign 0.10
R0193:Cadps2 UTSW 6 23,599,439 (GRCm39) missense probably benign 0.00
R0389:Cadps2 UTSW 6 23,321,781 (GRCm39) missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23,583,411 (GRCm39) missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23,321,703 (GRCm39) critical splice donor site probably null
R0620:Cadps2 UTSW 6 23,583,395 (GRCm39) missense probably damaging 1.00
R0831:Cadps2 UTSW 6 23,321,739 (GRCm39) missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23,328,775 (GRCm39) splice site probably benign
R0942:Cadps2 UTSW 6 23,263,561 (GRCm39) missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23,838,793 (GRCm39) missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23,583,472 (GRCm39) splice site probably benign
R1575:Cadps2 UTSW 6 23,429,217 (GRCm39) missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23,320,931 (GRCm39) critical splice donor site probably null
R1924:Cadps2 UTSW 6 23,688,857 (GRCm39) missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23,599,479 (GRCm39) missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23,287,685 (GRCm39) missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23,323,379 (GRCm39) missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23,839,121 (GRCm39) missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2147:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2148:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2150:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2219:Cadps2 UTSW 6 23,410,831 (GRCm39) missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23,323,339 (GRCm39) missense probably benign 0.15
R2338:Cadps2 UTSW 6 23,838,977 (GRCm39) splice site probably benign
R3861:Cadps2 UTSW 6 23,355,860 (GRCm39) missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23,528,125 (GRCm39) missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23,263,530 (GRCm39) utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23,599,462 (GRCm39) missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23,412,987 (GRCm39) missense probably benign 0.18
R4432:Cadps2 UTSW 6 23,626,737 (GRCm39) missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23,587,578 (GRCm39) missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23,688,859 (GRCm39) missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23,287,742 (GRCm39) missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23,626,667 (GRCm39) missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23,329,103 (GRCm39) missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23,328,804 (GRCm39) missense probably benign 0.28
R6074:Cadps2 UTSW 6 23,626,670 (GRCm39) missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23,329,162 (GRCm39) critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23,263,577 (GRCm39) missense probably benign 0.04
R6463:Cadps2 UTSW 6 23,323,333 (GRCm39) nonsense probably null
R6907:Cadps2 UTSW 6 23,599,505 (GRCm39) missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23,302,491 (GRCm39) missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23,583,458 (GRCm39) missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23,323,408 (GRCm39) missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23,410,888 (GRCm39) missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23,688,955 (GRCm39) missense probably benign 0.02
R7184:Cadps2 UTSW 6 23,583,428 (GRCm39) missense probably benign 0.18
R7325:Cadps2 UTSW 6 23,409,934 (GRCm39) missense unknown
R7526:Cadps2 UTSW 6 23,496,850 (GRCm39) missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23,626,607 (GRCm39) missense probably benign 0.15
R7772:Cadps2 UTSW 6 23,390,445 (GRCm39) missense probably benign 0.00
R7870:Cadps2 UTSW 6 23,263,641 (GRCm39) missense probably benign 0.14
R8040:Cadps2 UTSW 6 23,412,942 (GRCm39) splice site probably benign
R8048:Cadps2 UTSW 6 23,838,862 (GRCm39) missense probably benign 0.14
R8082:Cadps2 UTSW 6 23,323,313 (GRCm39) missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23,838,808 (GRCm39) missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23,328,897 (GRCm39) missense probably benign 0.00
R8497:Cadps2 UTSW 6 23,355,918 (GRCm39) missense probably benign 0.27
R8768:Cadps2 UTSW 6 23,382,938 (GRCm39) missense probably damaging 1.00
R8783:Cadps2 UTSW 6 23,302,303 (GRCm39) missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23,496,805 (GRCm39) missense probably damaging 1.00
R8832:Cadps2 UTSW 6 23,587,536 (GRCm39) missense possibly damaging 0.52
R8848:Cadps2 UTSW 6 23,344,256 (GRCm39) missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23,385,507 (GRCm39) missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23,410,876 (GRCm39) missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23,344,223 (GRCm39) missense probably benign 0.11
R8921:Cadps2 UTSW 6 23,302,300 (GRCm39) missense probably benign 0.00
R9228:Cadps2 UTSW 6 23,688,927 (GRCm39) missense probably benign 0.00
R9297:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9318:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9348:Cadps2 UTSW 6 23,344,262 (GRCm39) missense probably benign 0.20
R9447:Cadps2 UTSW 6 23,323,297 (GRCm39) missense probably damaging 0.96
R9484:Cadps2 UTSW 6 23,626,646 (GRCm39) missense probably benign 0.02
R9492:Cadps2 UTSW 6 23,427,238 (GRCm39) missense probably benign
R9630:Cadps2 UTSW 6 23,587,571 (GRCm39) missense probably benign 0.08
R9729:Cadps2 UTSW 6 23,382,982 (GRCm39) missense probably benign 0.28
Z1176:Cadps2 UTSW 6 23,321,800 (GRCm39) missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23,838,817 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,626,694 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,385,477 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCCAGCGATACCATTTCCTTTGGAC -3'
(R):5'- TCACAGGGGTGAACAATTCCAACAG -3'

Sequencing Primer
(F):5'- ATACCATTTCCTTTGGACTAGGAGC -3'
(R):5'- GGTGAACAATTCCAACAGCTATG -3'
Posted On 2013-07-30