Mutagenetix > Incidental Mutations

Incidental Mutation 'R0723:Cadps2'

63603

Institutional Source

Beutler Lab

Gene Symbol

Cadps2

Ensembl Gene

ENSMUSG00000017978

Gene Name

Ca2+-dependent activator protein for secretion 2

Synonyms

Caps2, cpd2, A230044C21Rik

MMRRC Submission

038905-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0723 (G1)

Quality Score

162

Status

Validated

Chromosome

Chromosomal Location

23262773-23839421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23287698 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1161 (V1161A)

Ref Sequence

ENSEMBL: ENSMUSP00000111015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]

Predicted Effect

probably benign
Transcript: ENSMUST00000018122
AA Change: V1201A

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: V1201A

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069074
AA Change: V1194A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: V1194A

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	895	5.54e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115358
AA Change: V1161A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: V1161A

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115361
AA Change: V1156A

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: V1156A

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	892	1.9e-49	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125350
AA Change: V796A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: V796A

Domain	Start	End	E-Value	Type
C2	14	112	1.51e-1	SMART
PH	137	241	2.94e-11	SMART
DUF1041	446	537	1.9e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142913
AA Change: V1172A

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: V1172A

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	22	39	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.14e-52	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152131

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156986

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163871
AA Change: V1201A

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: V1201A

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	7.2e-50	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166458
AA Change: V1172A

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: V1172A

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.05e-51	SMART

Meta Mutation Damage Score

0.2310

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.7%
20x: 96.0%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	A	4: 42,971,691	N341K	probably damaging	Het
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
4931423N10Rik	T	C	2: 23,256,924		probably benign	Het
8030411F24Rik	T	C	2: 148,783,362	I72T	probably damaging	Het
Acbd5	T	G	2: 23,069,596	V54G	probably damaging	Het
Acin1	A	T	14: 54,665,451	S255T	probably damaging	Het
Adcy2	A	G	13: 68,999,129	L56P	probably damaging	Het
Akap6	G	T	12: 53,141,902	C2033F	probably damaging	Het
Ano5	A	G	7: 51,587,758	I777V	probably benign	Het
Arhgef28	A	G	13: 97,939,479	V1349A	probably benign	Het
Bank1	T	C	3: 136,054,403		probably null	Het
C2cd5	T	C	6: 143,041,555		probably benign	Het
Car8	A	T	4: 8,169,703	D268E	probably benign	Het
Ckap5	T	A	2: 91,555,331	S175T	probably damaging	Het
Clk4	T	A	11: 51,275,493	Y67*	probably null	Het
Copg2	T	C	6: 30,815,982	I473V	possibly damaging	Het
Cyp2s1	C	T	7: 25,809,548	V43I	probably benign	Het
Ddx54	A	G	5: 120,623,638	D493G	probably benign	Het
Efemp2	T	C	19: 5,480,050	S140P	probably damaging	Het
Fam214a	G	A	9: 75,009,451	G444E	probably damaging	Het
Fat1	C	A	8: 45,026,749	T2944K	probably damaging	Het
Fgfr1	T	A	8: 25,557,768	D43E	probably damaging	Het
Fry	G	A	5: 150,496,360	A996T	probably damaging	Het
Fyb2	G	A	4: 105,015,866	V784I	probably benign	Het
Gm6507	T	A	6: 89,185,162		noncoding transcript	Het
Gm7964	T	C	7: 83,756,166		noncoding transcript	Het
Gucy2c	T	C	6: 136,727,801		probably null	Het
Hdac10	A	T	15: 89,126,418	L259Q	probably damaging	Het
Hoxd9	A	T	2: 74,698,828	D258V	probably damaging	Het
Hs3st3b1	T	C	11: 63,921,575	T105A	probably benign	Het
Hsd17b7	A	G	1: 169,956,026	L271P	probably damaging	Het
Ifnlr1	T	A	4: 135,701,213		probably benign	Het
Kif22	A	T	7: 127,033,906	M121K	probably damaging	Het
Kl	G	A	5: 150,953,101	D129N	probably damaging	Het
Mettl13	A	T	1: 162,534,430	I648N	probably damaging	Het
Mlh1	C	T	9: 111,271,472	R18H	probably damaging	Het
Mtmr14	T	C	6: 113,270,512		probably benign	Het
Myo15	C	A	11: 60,478,977	N854K	possibly damaging	Het
Myo1h	T	C	5: 114,319,680	I84T	probably benign	Het
Myo9a	A	T	9: 59,871,100	S1380C	probably benign	Het
Myof	A	G	19: 37,981,260	V318A	probably damaging	Het
N4bp2l2	A	G	5: 150,662,432	S28P	probably damaging	Het
Narfl	G	A	17: 25,781,821	V406M	probably damaging	Het
Nbr1	C	T	11: 101,576,319	Q570*	probably null	Het
Nhp2	C	T	11: 51,619,923	Q36*	probably null	Het
Olfr23	T	G	11: 73,940,270	V8G	probably benign	Het
Olfr884	G	T	9: 38,047,827	V202L	probably benign	Het
Poc1b	T	A	10: 99,129,595	W129R	probably damaging	Het
Rapgef2	C	T	3: 79,079,174	E1018K	probably benign	Het
Rgs12	T	C	5: 35,024,366		probably benign	Het
Rufy2	G	A	10: 62,998,094	V280I	probably benign	Het
Snx2	A	G	18: 53,210,372	I281V	probably benign	Het
Spag5	C	A	11: 78,319,584		probably benign	Het
Stxbp5	A	T	10: 9,768,873	I961N	probably damaging	Het
Tet2	T	C	3: 133,467,284	E1739G	probably benign	Het
Tmod2	A	G	9: 75,595,055	F50S	possibly damaging	Het
Tnfsf13b	T	G	8: 10,007,166		probably null	Het
Ttn	T	C	2: 76,786,335	K16525E	possibly damaging	Het
Txnrd2	T	C	16: 18,440,879		probably benign	Het
Ubr1	A	T	2: 120,881,101	Y1437*	probably null	Het
Vwf	C	A	6: 125,566,262	D170E	probably benign	Het
Wdr95	C	G	5: 149,574,048	I230M	probably damaging	Het
Xirp2	C	T	2: 67,512,215	S1600F	probably damaging	Het
Zfp12	A	G	5: 143,244,883	K322E	probably damaging	Het

Other mutations in Cadps2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Cadps2	APN	6	23496874	missense	possibly damaging	0.84
IGL01105:Cadps2	APN	6	23321700	splice site	probably benign
IGL01317:Cadps2	APN	6	23314173	missense	possibly damaging	0.76
IGL01409:Cadps2	APN	6	23587441	missense	probably damaging	1.00
IGL01477:Cadps2	APN	6	23263673	missense	probably damaging	1.00
IGL01620:Cadps2	APN	6	23587462	missense	probably benign	0.19
IGL01674:Cadps2	APN	6	23355852	missense	probably damaging	1.00
IGL01675:Cadps2	APN	6	23382905	missense	probably damaging	1.00
IGL01895:Cadps2	APN	6	23427275	missense	probably damaging	0.98
IGL02095:Cadps2	APN	6	23427310	missense	probably benign	0.01
IGL02200:Cadps2	APN	6	23385528	missense	probably damaging	1.00
IGL02380:Cadps2	APN	6	23287732	missense	probably benign	0.11
IGL02680:Cadps2	APN	6	23838896	missense	probably damaging	0.99
IGL02814:Cadps2	APN	6	23321707	missense	probably damaging	1.00
IGL02940:Cadps2	APN	6	23496809	missense	probably benign	0.08
IGL03061:Cadps2	APN	6	23287660	splice site	probably null
IGL03233:Cadps2	APN	6	23263601	missense	probably benign	0.10
R0193:Cadps2	UTSW	6	23599440	missense	probably benign	0.00
R0389:Cadps2	UTSW	6	23321782	missense	possibly damaging	0.88
R0571:Cadps2	UTSW	6	23583412	missense	probably damaging	1.00
R0595:Cadps2	UTSW	6	23321704	critical splice donor site	probably null
R0620:Cadps2	UTSW	6	23583396	missense	probably damaging	1.00
R0831:Cadps2	UTSW	6	23321740	missense	possibly damaging	0.88
R0836:Cadps2	UTSW	6	23328776	splice site	probably benign
R0942:Cadps2	UTSW	6	23263562	missense	probably damaging	1.00
R1099:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R1120:Cadps2	UTSW	6	23838794	missense	probably damaging	1.00
R1216:Cadps2	UTSW	6	23583473	splice site	probably benign
R1575:Cadps2	UTSW	6	23429218	missense	probably damaging	1.00
R1780:Cadps2	UTSW	6	23320932	critical splice donor site	probably null
R1924:Cadps2	UTSW	6	23688858	missense	probably damaging	0.99
R1944:Cadps2	UTSW	6	23599480	missense	probably damaging	0.99
R1956:Cadps2	UTSW	6	23287686	missense	probably damaging	1.00
R1986:Cadps2	UTSW	6	23323380	missense	probably damaging	1.00
R2045:Cadps2	UTSW	6	23839122	missense	possibly damaging	0.73
R2146:Cadps2	UTSW	6	23838999	intron	probably benign
R2147:Cadps2	UTSW	6	23838999	intron	probably benign
R2148:Cadps2	UTSW	6	23838999	intron	probably benign
R2150:Cadps2	UTSW	6	23838999	intron	probably benign
R2219:Cadps2	UTSW	6	23410832	missense	probably damaging	1.00
R2264:Cadps2	UTSW	6	23323340	missense	probably benign	0.15
R2338:Cadps2	UTSW	6	23838978	splice site	probably benign
R3861:Cadps2	UTSW	6	23355861	missense	probably damaging	1.00
R3898:Cadps2	UTSW	6	23528126	missense	probably damaging	1.00
R3982:Cadps2	UTSW	6	23263531	utr 3 prime	probably benign
R4213:Cadps2	UTSW	6	23599463	missense	probably damaging	1.00
R4384:Cadps2	UTSW	6	23412988	missense	probably benign	0.18
R4432:Cadps2	UTSW	6	23626738	missense	probably damaging	0.99
R4609:Cadps2	UTSW	6	23587579	missense	probably damaging	1.00
R4806:Cadps2	UTSW	6	23688860	missense	probably damaging	0.96
R4977:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R5174:Cadps2	UTSW	6	23287743	missense	probably damaging	1.00
R5267:Cadps2	UTSW	6	23626668	missense	possibly damaging	0.79
R5389:Cadps2	UTSW	6	23329104	missense	probably damaging	1.00
R5737:Cadps2	UTSW	6	23328805	missense	probably benign	0.28
R6074:Cadps2	UTSW	6	23626671	missense	probably damaging	1.00
R6254:Cadps2	UTSW	6	23329163	critical splice acceptor site	probably null
R6323:Cadps2	UTSW	6	23263578	missense	probably benign	0.04
R6463:Cadps2	UTSW	6	23323334	nonsense	probably null
R6907:Cadps2	UTSW	6	23599506	missense	probably damaging	1.00
R6940:Cadps2	UTSW	6	23302492	missense	probably damaging	1.00
R6964:Cadps2	UTSW	6	23583459	missense	probably damaging	1.00
R7079:Cadps2	UTSW	6	23323409	missense	probably damaging	1.00
R7139:Cadps2	UTSW	6	23410889	missense	probably damaging	1.00
R7156:Cadps2	UTSW	6	23688956	missense	probably benign	0.02
R7184:Cadps2	UTSW	6	23583429	missense	probably benign	0.18
R7325:Cadps2	UTSW	6	23409935	missense	unknown
R7526:Cadps2	UTSW	6	23496851	missense	probably damaging	1.00
R7546:Cadps2	UTSW	6	23626608	missense	probably benign	0.15
R7772:Cadps2	UTSW	6	23390446	missense	probably benign	0.00
R7870:Cadps2	UTSW	6	23263642	missense	probably benign	0.14
R8040:Cadps2	UTSW	6	23412943	splice site	probably benign
R8048:Cadps2	UTSW	6	23838863	missense	probably benign	0.14
R8082:Cadps2	UTSW	6	23323314	missense	probably damaging	1.00
R8100:Cadps2	UTSW	6	23838809	missense	probably damaging	1.00
R8115:Cadps2	UTSW	6	23328898	missense	probably benign	0.00
Z1176:Cadps2	UTSW	6	23321801	missense	probably benign	0.24
Z1177:Cadps2	UTSW	6	23385478	missense	possibly damaging	0.88
Z1177:Cadps2	UTSW	6	23626695	missense	probably damaging	1.00
Z1177:Cadps2	UTSW	6	23838818	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGCGATACCATTTCCTTTGGAC -3'
(R):5'- TCACAGGGGTGAACAATTCCAACAG -3'

Sequencing Primer
(F):5'- ATACCATTTCCTTTGGACTAGGAGC -3'
(R):5'- GGTGAACAATTCCAACAGCTATG -3'

Posted On

2013-07-30