Incidental Mutation 'R8209:Irak4'
ID636081
Institutional Source Beutler Lab
Gene Symbol Irak4
Ensembl Gene ENSMUSG00000059883
Gene Nameinterleukin-1 receptor-associated kinase 4
SynonymsIRAK-4, 8430405M07Rik, NY-REN-64, 9330209D03Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_029926; VEGA: OTTMUST00000040437; MGI: 2182474

Is this an essential gene? Possibly essential (E-score: 0.556) question?
Stock #R8209 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location94543643-94581815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94558363 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 277 (L277Q)
Ref Sequence ENSEMBL: ENSMUSP00000074471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074936] [ENSMUST00000109248]
PDB Structure
Solution structure of the DEATH domain of Interleukin-1 receptor-associated kinase4 (IRAK4) from Mus musculus [SOLUTION NMR]
Molecular Structure of the Interleukin-1 Receptor-Associated Kinase-4 Death Domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000074936
AA Change: L277Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074471
Gene: ENSMUSG00000059883
AA Change: L277Q

DomainStartEndE-ValueType
PDB:1WH4|A 1 114 1e-78 PDB
Pfam:Pkinase_Tyr 187 454 3.3e-53 PFAM
Pfam:Pkinase 187 456 4.9e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109248
AA Change: L277Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104871
Gene: ENSMUSG00000059883
AA Change: L277Q

DomainStartEndE-ValueType
Pfam:Death 20 101 1.6e-6 PFAM
Pfam:Pkinase_Tyr 187 452 1.9e-51 PFAM
Pfam:Pkinase 188 452 1.3e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase that activates NF-kappaB in both the Toll-like receptor (TLR) and T-cell receptor (TCR) signaling pathways. The protein is essential for most innate immune responses. Mutations in this gene result in IRAK4 deficiency and recurrent invasive pneumococcal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutant mice exhibit defects of the innate immune system and show increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(5) Chemically induced(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A G 10: 29,218,199 N27S probably damaging Het
Akr1b3 G C 6: 34,311,932 T114R probably damaging Het
Alx4 T C 2: 93,675,351 M266T possibly damaging Het
Arhgap21 C T 2: 20,871,745 D820N probably damaging Het
Clec4a1 A G 6: 122,930,814 S154G probably damaging Het
Col11a2 T C 17: 34,047,279 probably null Het
Dnaaf2 A T 12: 69,198,092 V65E probably damaging Het
Dnah14 A G 1: 181,795,545 E3996G possibly damaging Het
Dsg1b A G 18: 20,408,890 Y818C probably benign Het
Dzip3 C T 16: 48,977,944 G133S probably damaging Het
Efcab6 T C 15: 83,904,255 Y946C probably benign Het
Eprs A G 1: 185,407,615 E967G possibly damaging Het
F5 T C 1: 164,194,390 V1478A probably benign Het
Fchsd2 C T 7: 101,282,472 P745L probably damaging Het
Gart T C 16: 91,628,153 I661V possibly damaging Het
Gm14295 T A 2: 176,811,177 I820K unknown Het
Gm9573 T C 17: 35,619,707 probably benign Het
Grb10 G T 11: 11,951,533 L214M probably damaging Het
Gria2 A G 3: 80,709,457 V396A probably benign Het
Il17rc C A 6: 113,472,810 Q126K probably benign Het
Ipo8 A G 6: 148,796,678 I615T possibly damaging Het
Islr T C 9: 58,158,057 S56G probably damaging Het
Krt78 A T 15: 101,947,045 M777K possibly damaging Het
Lrch4 A G 5: 137,639,735 H93R Het
Nbeal1 A T 1: 60,277,177 K1846N probably damaging Het
Nedd1 T A 10: 92,691,935 M466L probably benign Het
Nup107 T C 10: 117,757,931 K786E probably benign Het
Olfr1024 T C 2: 85,904,203 I284V probably benign Het
Olfr560 T C 7: 102,753,743 Y62C probably benign Het
Olfr995 T A 2: 85,438,637 I174F probably damaging Het
Phc2 T C 4: 128,709,506 L143P probably benign Het
Pkhd1l1 A G 15: 44,574,407 N3533D possibly damaging Het
Plpp1 A T 13: 112,866,931 T230S probably benign Het
Prokr2 C A 2: 132,374,041 A167S probably damaging Het
Qser1 C T 2: 104,788,725 A491T probably benign Het
Rc3h2 T A 2: 37,376,989 Y1040F possibly damaging Het
Rgl2 C T 17: 33,932,527 L182F possibly damaging Het
Rnf130 T C 11: 50,071,270 V181A probably benign Het
Scn7a T G 2: 66,700,860 I558L possibly damaging Het
Shtn1 T C 19: 59,003,896 I417V possibly damaging Het
Slco1a5 T G 6: 142,262,682 N128H probably damaging Het
Smg5 C T 3: 88,351,531 A603V probably benign Het
Svs3b T A 2: 164,256,220 E60D possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Timm44 A T 8: 4,266,844 M263K probably benign Het
Tmem150b A G 7: 4,720,692 L162P probably damaging Het
Tmprss11f A G 5: 86,539,707 V114A probably damaging Het
Trak1 C T 9: 121,451,727 T394I probably benign Het
Tram2 A C 1: 21,005,577 Y206D probably damaging Het
Trhde C T 10: 114,567,228 V497M probably damaging Het
Trpc2 A G 7: 102,088,275 M425V possibly damaging Het
Tuba1b C T 15: 98,931,710 G410S probably benign Het
Vmn2r1 A G 3: 64,089,778 D285G possibly damaging Het
Zfp536 A T 7: 37,568,655 S445R probably benign Het
Zfp606 A T 7: 12,493,307 T452S probably benign Het
Other mutations in Irak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Irak4 APN 15 94556628 missense probably benign 0.09
IGL00688:Irak4 APN 15 94566863 missense possibly damaging 0.68
IGL01870:Irak4 APN 15 94547870 missense probably benign 0.28
IGL02740:Irak4 APN 15 94567044 makesense probably null
IGL02897:Irak4 APN 15 94553991 missense probably benign 0.00
IGL03290:Irak4 APN 15 94551899 missense probably benign 0.01
otiose UTSW 15 94561484 missense probably damaging 1.00
R0057:Irak4 UTSW 15 94553872 missense probably benign 0.00
R2010:Irak4 UTSW 15 94551806 missense probably damaging 1.00
R3751:Irak4 UTSW 15 94561595 missense probably damaging 1.00
R3752:Irak4 UTSW 15 94561595 missense probably damaging 1.00
R3753:Irak4 UTSW 15 94561595 missense probably damaging 1.00
R3973:Irak4 UTSW 15 94554740 missense possibly damaging 0.73
R4687:Irak4 UTSW 15 94566823 missense probably damaging 1.00
R4704:Irak4 UTSW 15 94566900 splice site probably null
R5001:Irak4 UTSW 15 94558273 missense possibly damaging 0.91
R5392:Irak4 UTSW 15 94556684 missense probably benign
R5392:Irak4 UTSW 15 94556685 missense probably benign 0.39
R6280:Irak4 UTSW 15 94551810 nonsense probably null
R6390:Irak4 UTSW 15 94561486 missense probably damaging 1.00
R7643:Irak4 UTSW 15 94558828 missense probably benign 0.05
R8222:Irak4 UTSW 15 94561229 splice site probably null
R8226:Irak4 UTSW 15 94558363 missense probably damaging 1.00
R8512:Irak4 UTSW 15 94566778 missense probably benign
V8831:Irak4 UTSW 15 94561484 missense probably damaging 1.00
X0019:Irak4 UTSW 15 94554000 missense probably benign 0.00
X0027:Irak4 UTSW 15 94551930 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGGTATCTCCTAGATCTTTC -3'
(R):5'- TCAACATCTAGCCTTGGCTG -3'

Sequencing Primer
(F):5'- AAATTCTTAAATCTAGTAACCCCTGC -3'
(R):5'- CATCTAGCCTTGGCTGATGCG -3'
Posted On2020-07-13