Incidental Mutation 'R8209:Tuba1b'
ID636082
Institutional Source Beutler Lab
Gene Symbol Tuba1b
Ensembl Gene ENSMUSG00000023004
Gene Nametubulin, alpha 1B
SynonymsTuba2
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R8209 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location98931425-98934565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98931710 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 410 (G410S)
Ref Sequence ENSEMBL: ENSMUSP00000076777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077577]
Predicted Effect probably benign
Transcript: ENSMUST00000077577
AA Change: G410S

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000076777
Gene: ENSMUSG00000023004
AA Change: G410S

DomainStartEndE-ValueType
Tubulin 49 246 6.98e-83 SMART
Tubulin_C 248 393 3.2e-59 SMART
low complexity region 433 450 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A G 10: 29,218,199 N27S probably damaging Het
Akr1b3 G C 6: 34,311,932 T114R probably damaging Het
Alx4 T C 2: 93,675,351 M266T possibly damaging Het
Arhgap21 C T 2: 20,871,745 D820N probably damaging Het
Clec4a1 A G 6: 122,930,814 S154G probably damaging Het
Col11a2 T C 17: 34,047,279 probably null Het
Dnaaf2 A T 12: 69,198,092 V65E probably damaging Het
Dnah14 A G 1: 181,795,545 E3996G possibly damaging Het
Dsg1b A G 18: 20,408,890 Y818C probably benign Het
Dzip3 C T 16: 48,977,944 G133S probably damaging Het
Efcab6 T C 15: 83,904,255 Y946C probably benign Het
Eprs A G 1: 185,407,615 E967G possibly damaging Het
F5 T C 1: 164,194,390 V1478A probably benign Het
Fchsd2 C T 7: 101,282,472 P745L probably damaging Het
Gart T C 16: 91,628,153 I661V possibly damaging Het
Gm14295 T A 2: 176,811,177 I820K unknown Het
Gm9573 T C 17: 35,619,707 probably benign Het
Grb10 G T 11: 11,951,533 L214M probably damaging Het
Gria2 A G 3: 80,709,457 V396A probably benign Het
Il17rc C A 6: 113,472,810 Q126K probably benign Het
Ipo8 A G 6: 148,796,678 I615T possibly damaging Het
Irak4 T A 15: 94,558,363 L277Q probably damaging Het
Islr T C 9: 58,158,057 S56G probably damaging Het
Krt78 A T 15: 101,947,045 M777K possibly damaging Het
Lrch4 A G 5: 137,639,735 H93R Het
Nbeal1 A T 1: 60,277,177 K1846N probably damaging Het
Nedd1 T A 10: 92,691,935 M466L probably benign Het
Nup107 T C 10: 117,757,931 K786E probably benign Het
Olfr1024 T C 2: 85,904,203 I284V probably benign Het
Olfr560 T C 7: 102,753,743 Y62C probably benign Het
Olfr995 T A 2: 85,438,637 I174F probably damaging Het
Phc2 T C 4: 128,709,506 L143P probably benign Het
Pkhd1l1 A G 15: 44,574,407 N3533D possibly damaging Het
Plpp1 A T 13: 112,866,931 T230S probably benign Het
Prokr2 C A 2: 132,374,041 A167S probably damaging Het
Qser1 C T 2: 104,788,725 A491T probably benign Het
Rc3h2 T A 2: 37,376,989 Y1040F possibly damaging Het
Rgl2 C T 17: 33,932,527 L182F possibly damaging Het
Rnf130 T C 11: 50,071,270 V181A probably benign Het
Scn7a T G 2: 66,700,860 I558L possibly damaging Het
Shtn1 T C 19: 59,003,896 I417V possibly damaging Het
Slco1a5 T G 6: 142,262,682 N128H probably damaging Het
Smg5 C T 3: 88,351,531 A603V probably benign Het
Svs3b T A 2: 164,256,220 E60D possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Timm44 A T 8: 4,266,844 M263K probably benign Het
Tmem150b A G 7: 4,720,692 L162P probably damaging Het
Tmprss11f A G 5: 86,539,707 V114A probably damaging Het
Trak1 C T 9: 121,451,727 T394I probably benign Het
Tram2 A C 1: 21,005,577 Y206D probably damaging Het
Trhde C T 10: 114,567,228 V497M probably damaging Het
Trpc2 A G 7: 102,088,275 M425V possibly damaging Het
Vmn2r1 A G 3: 64,089,778 D285G possibly damaging Het
Zfp536 A T 7: 37,568,655 S445R probably benign Het
Zfp606 A T 7: 12,493,307 T452S probably benign Het
Other mutations in Tuba1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Tuba1b APN 15 98932457 missense possibly damaging 0.93
R3147:Tuba1b UTSW 15 98932505 missense probably benign 0.01
R6471:Tuba1b UTSW 15 98932447 missense probably benign 0.05
R8226:Tuba1b UTSW 15 98931710 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGGAGCAGTTTGACGACACAG -3'
(R):5'- CTGCCATTGCCACCATCAAG -3'

Sequencing Primer
(F):5'- TTTGACGACACAGGGGGCTC -3'
(R):5'- CGCAGCATCCAGTTTGTAGACTG -3'
Posted On2020-07-13