Incidental Mutation 'R8209:Dzip3'
ID636084
Institutional Source Beutler Lab
Gene Symbol Dzip3
Ensembl Gene ENSMUSG00000064061
Gene NameDAZ interacting protein 3, zinc finger
Synonyms2A-HUB, 6430549P11Rik, 2310047C04Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001110017.1, NM_027341.2; Ensembl: ENSMUST00000121869

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8209 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location48924232-48994165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48977944 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 133 (G133S)
Ref Sequence ENSEMBL: ENSMUSP00000110161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]
Predicted Effect probably damaging
Transcript: ENSMUST00000114516
AA Change: G133S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061
AA Change: G133S

DomainStartEndE-ValueType
low complexity region 451 472 N/A INTRINSIC
coiled coil region 548 568 N/A INTRINSIC
coiled coil region 599 650 N/A INTRINSIC
low complexity region 743 754 N/A INTRINSIC
low complexity region 883 891 N/A INTRINSIC
RING 938 977 2.09e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121869
AA Change: G133S

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061
AA Change: G133S

DomainStartEndE-ValueType
low complexity region 657 678 N/A INTRINSIC
coiled coil region 754 774 N/A INTRINSIC
coiled coil region 805 856 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 1089 1097 N/A INTRINSIC
RING 1144 1183 2.09e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A G 10: 29,218,199 N27S probably damaging Het
Akr1b3 G C 6: 34,311,932 T114R probably damaging Het
Alx4 T C 2: 93,675,351 M266T possibly damaging Het
Arhgap21 C T 2: 20,871,745 D820N probably damaging Het
Clec4a1 A G 6: 122,930,814 S154G probably damaging Het
Col11a2 T C 17: 34,047,279 probably null Het
Dnaaf2 A T 12: 69,198,092 V65E probably damaging Het
Dnah14 A G 1: 181,795,545 E3996G possibly damaging Het
Dsg1b A G 18: 20,408,890 Y818C probably benign Het
Efcab6 T C 15: 83,904,255 Y946C probably benign Het
Eprs A G 1: 185,407,615 E967G possibly damaging Het
F5 T C 1: 164,194,390 V1478A probably benign Het
Fchsd2 C T 7: 101,282,472 P745L probably damaging Het
Gart T C 16: 91,628,153 I661V possibly damaging Het
Gm14295 T A 2: 176,811,177 I820K unknown Het
Gm9573 T C 17: 35,619,707 probably benign Het
Grb10 G T 11: 11,951,533 L214M probably damaging Het
Gria2 A G 3: 80,709,457 V396A probably benign Het
Il17rc C A 6: 113,472,810 Q126K probably benign Het
Ipo8 A G 6: 148,796,678 I615T possibly damaging Het
Irak4 T A 15: 94,558,363 L277Q probably damaging Het
Islr T C 9: 58,158,057 S56G probably damaging Het
Krt78 A T 15: 101,947,045 M777K possibly damaging Het
Lrch4 A G 5: 137,639,735 H93R Het
Nbeal1 A T 1: 60,277,177 K1846N probably damaging Het
Nedd1 T A 10: 92,691,935 M466L probably benign Het
Nup107 T C 10: 117,757,931 K786E probably benign Het
Olfr1024 T C 2: 85,904,203 I284V probably benign Het
Olfr560 T C 7: 102,753,743 Y62C probably benign Het
Olfr995 T A 2: 85,438,637 I174F probably damaging Het
Phc2 T C 4: 128,709,506 L143P probably benign Het
Pkhd1l1 A G 15: 44,574,407 N3533D possibly damaging Het
Plpp1 A T 13: 112,866,931 T230S probably benign Het
Prokr2 C A 2: 132,374,041 A167S probably damaging Het
Qser1 C T 2: 104,788,725 A491T probably benign Het
Rc3h2 T A 2: 37,376,989 Y1040F possibly damaging Het
Rgl2 C T 17: 33,932,527 L182F possibly damaging Het
Rnf130 T C 11: 50,071,270 V181A probably benign Het
Scn7a T G 2: 66,700,860 I558L possibly damaging Het
Shtn1 T C 19: 59,003,896 I417V possibly damaging Het
Slco1a5 T G 6: 142,262,682 N128H probably damaging Het
Smg5 C T 3: 88,351,531 A603V probably benign Het
Svs3b T A 2: 164,256,220 E60D possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Timm44 A T 8: 4,266,844 M263K probably benign Het
Tmem150b A G 7: 4,720,692 L162P probably damaging Het
Tmprss11f A G 5: 86,539,707 V114A probably damaging Het
Trak1 C T 9: 121,451,727 T394I probably benign Het
Tram2 A C 1: 21,005,577 Y206D probably damaging Het
Trhde C T 10: 114,567,228 V497M probably damaging Het
Trpc2 A G 7: 102,088,275 M425V possibly damaging Het
Tuba1b C T 15: 98,931,710 G410S probably benign Het
Vmn2r1 A G 3: 64,089,778 D285G possibly damaging Het
Zfp536 A T 7: 37,568,655 S445R probably benign Het
Zfp606 A T 7: 12,493,307 T452S probably benign Het
Other mutations in Dzip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Dzip3 APN 16 48928415 missense probably damaging 1.00
IGL00931:Dzip3 APN 16 48935497 critical splice donor site probably null
IGL01109:Dzip3 APN 16 48929674 missense probably benign 0.27
IGL01121:Dzip3 APN 16 48944881 missense probably benign 0.10
IGL01328:Dzip3 APN 16 48972258 missense probably damaging 1.00
IGL01729:Dzip3 APN 16 48928363 missense possibly damaging 0.78
IGL02044:Dzip3 APN 16 48948427 missense possibly damaging 0.90
IGL02051:Dzip3 APN 16 48972254 missense probably benign 0.01
IGL02115:Dzip3 APN 16 48948485 missense probably benign 0.00
IGL02125:Dzip3 APN 16 48927596 missense probably damaging 1.00
IGL02136:Dzip3 APN 16 48927582 missense possibly damaging 0.94
IGL02244:Dzip3 APN 16 48980988 missense probably benign 0.01
IGL02253:Dzip3 APN 16 48944924 missense probably benign 0.34
IGL02412:Dzip3 APN 16 48958457 missense probably benign 0.00
IGL02452:Dzip3 APN 16 48938537 splice site probably benign
IGL02481:Dzip3 APN 16 48975551 splice site probably benign
IGL02499:Dzip3 APN 16 48933850 missense probably damaging 1.00
IGL02511:Dzip3 APN 16 48936980 missense possibly damaging 0.75
IGL02519:Dzip3 APN 16 48928396 missense probably damaging 1.00
IGL02610:Dzip3 APN 16 48951653 missense probably damaging 1.00
IGL03129:Dzip3 APN 16 48942083 missense possibly damaging 0.51
IGL03342:Dzip3 APN 16 48929623 missense probably damaging 0.98
IGL03493:Dzip3 APN 16 48951696 missense probably benign 0.32
dazwick UTSW 16 48958465 missense possibly damaging 0.90
1mM(1):Dzip3 UTSW 16 48951557 missense probably damaging 1.00
PIT4651001:Dzip3 UTSW 16 48944878 missense probably benign
R0313:Dzip3 UTSW 16 48937061 missense probably damaging 0.99
R0483:Dzip3 UTSW 16 48947713 missense possibly damaging 0.94
R0504:Dzip3 UTSW 16 48959643 splice site probably benign
R0744:Dzip3 UTSW 16 48959675 missense probably damaging 1.00
R0800:Dzip3 UTSW 16 48953808 splice site probably benign
R0927:Dzip3 UTSW 16 48975477 missense probably damaging 0.99
R0931:Dzip3 UTSW 16 48951558 missense probably damaging 1.00
R1170:Dzip3 UTSW 16 48961208 missense probably damaging 1.00
R1203:Dzip3 UTSW 16 48951817 missense probably damaging 1.00
R1205:Dzip3 UTSW 16 48951681 missense probably damaging 1.00
R1442:Dzip3 UTSW 16 48945622 missense probably benign 0.19
R1526:Dzip3 UTSW 16 48937006 missense probably damaging 1.00
R1560:Dzip3 UTSW 16 48951540 splice site probably null
R1585:Dzip3 UTSW 16 48977878 splice site probably benign
R1682:Dzip3 UTSW 16 48958417 critical splice donor site probably null
R1957:Dzip3 UTSW 16 48927593 missense probably damaging 1.00
R2472:Dzip3 UTSW 16 48953787 missense possibly damaging 0.85
R2571:Dzip3 UTSW 16 48972218 splice site probably null
R3040:Dzip3 UTSW 16 48928324 missense probably damaging 1.00
R3081:Dzip3 UTSW 16 48927558 missense probably damaging 1.00
R3615:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3616:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3786:Dzip3 UTSW 16 48975543 missense probably benign 0.08
R3851:Dzip3 UTSW 16 48950013 missense possibly damaging 0.94
R4097:Dzip3 UTSW 16 48958489 nonsense probably null
R4371:Dzip3 UTSW 16 48943455 critical splice donor site probably null
R4612:Dzip3 UTSW 16 48952040 nonsense probably null
R4671:Dzip3 UTSW 16 48979590 nonsense probably null
R4695:Dzip3 UTSW 16 48951561 missense probably damaging 1.00
R4696:Dzip3 UTSW 16 48925969 unclassified probably benign
R4769:Dzip3 UTSW 16 48938474 missense probably damaging 0.97
R5063:Dzip3 UTSW 16 48953754 nonsense probably null
R5321:Dzip3 UTSW 16 48957675 missense possibly damaging 0.95
R5764:Dzip3 UTSW 16 48927361 intron probably benign
R6020:Dzip3 UTSW 16 48951842 missense probably damaging 1.00
R6218:Dzip3 UTSW 16 48958465 missense possibly damaging 0.90
R6300:Dzip3 UTSW 16 48951807 missense probably damaging 1.00
R6365:Dzip3 UTSW 16 48931273 missense probably damaging 0.96
R6778:Dzip3 UTSW 16 48982083 missense probably benign 0.00
R6915:Dzip3 UTSW 16 48942125 missense possibly damaging 0.72
R7047:Dzip3 UTSW 16 48982126 missense probably benign 0.04
R7059:Dzip3 UTSW 16 48980942 missense probably benign 0.34
R7095:Dzip3 UTSW 16 48927790 missense probably benign
R7227:Dzip3 UTSW 16 48951569 missense probably damaging 0.99
R7319:Dzip3 UTSW 16 48927540 critical splice donor site probably null
R7436:Dzip3 UTSW 16 48951989 missense probably damaging 1.00
R7469:Dzip3 UTSW 16 48944879 missense probably benign
R7526:Dzip3 UTSW 16 48975474 missense probably damaging 0.99
R7964:Dzip3 UTSW 16 48951905 missense probably damaging 1.00
R8131:Dzip3 UTSW 16 48933793 critical splice donor site probably null
R8188:Dzip3 UTSW 16 48952136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTAATTTCCAGATTCTATTCATCTG -3'
(R):5'- AAATGACATGCTTCCCTGTTTT -3'

Sequencing Primer
(F):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- GTAATAAAATGAGAATTTGCACC -3'
Posted On2020-07-13