Incidental Mutation 'R0723:Cyp2s1'
ID63609
Institutional Source Beutler Lab
Gene Symbol Cyp2s1
Ensembl Gene ENSMUSG00000040703
Gene Namecytochrome P450, family 2, subfamily s, polypeptide 1
Synonyms1200011C15Rik
MMRRC Submission 038905-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0723 (G1)
Quality Score163
Status Validated
Chromosome7
Chromosomal Location25802475-25816913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25809548 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 43 (V43I)
Ref Sequence ENSEMBL: ENSMUSP00000122264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043314] [ENSMUST00000108395] [ENSMUST00000156714]
Predicted Effect probably benign
Transcript: ENSMUST00000043314
AA Change: V183I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000041175
Gene: ENSMUSG00000040703
AA Change: V183I

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:p450 34 493 6.4e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108395
AA Change: V183I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000104032
Gene: ENSMUSG00000040703
AA Change: V183I

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:p450 34 440 4e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152560
Predicted Effect probably benign
Transcript: ENSMUST00000156714
AA Change: V43I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000122264
Gene: ENSMUSG00000040703
AA Change: V43I

DomainStartEndE-ValueType
Pfam:p450 1 91 1.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206602
Meta Mutation Damage Score 0.0771 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. In rodents, the homologous protein has been shown to metabolize certain carcinogens; however, the specific function of the human protein has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and appear normal in terms of body weight, growth rate, organ weight, and daily activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,691 N341K probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4931423N10Rik T C 2: 23,256,924 probably benign Het
8030411F24Rik T C 2: 148,783,362 I72T probably damaging Het
Acbd5 T G 2: 23,069,596 V54G probably damaging Het
Acin1 A T 14: 54,665,451 S255T probably damaging Het
Adcy2 A G 13: 68,999,129 L56P probably damaging Het
Akap6 G T 12: 53,141,902 C2033F probably damaging Het
Ano5 A G 7: 51,587,758 I777V probably benign Het
Arhgef28 A G 13: 97,939,479 V1349A probably benign Het
Bank1 T C 3: 136,054,403 probably null Het
C2cd5 T C 6: 143,041,555 probably benign Het
Cadps2 A G 6: 23,287,698 V1161A probably damaging Het
Car8 A T 4: 8,169,703 D268E probably benign Het
Ckap5 T A 2: 91,555,331 S175T probably damaging Het
Clk4 T A 11: 51,275,493 Y67* probably null Het
Copg2 T C 6: 30,815,982 I473V possibly damaging Het
Ddx54 A G 5: 120,623,638 D493G probably benign Het
Efemp2 T C 19: 5,480,050 S140P probably damaging Het
Fam214a G A 9: 75,009,451 G444E probably damaging Het
Fat1 C A 8: 45,026,749 T2944K probably damaging Het
Fgfr1 T A 8: 25,557,768 D43E probably damaging Het
Fry G A 5: 150,496,360 A996T probably damaging Het
Fyb2 G A 4: 105,015,866 V784I probably benign Het
Gm6507 T A 6: 89,185,162 noncoding transcript Het
Gm7964 T C 7: 83,756,166 noncoding transcript Het
Gucy2c T C 6: 136,727,801 probably null Het
Hdac10 A T 15: 89,126,418 L259Q probably damaging Het
Hoxd9 A T 2: 74,698,828 D258V probably damaging Het
Hs3st3b1 T C 11: 63,921,575 T105A probably benign Het
Hsd17b7 A G 1: 169,956,026 L271P probably damaging Het
Ifnlr1 T A 4: 135,701,213 probably benign Het
Kif22 A T 7: 127,033,906 M121K probably damaging Het
Kl G A 5: 150,953,101 D129N probably damaging Het
Mettl13 A T 1: 162,534,430 I648N probably damaging Het
Mlh1 C T 9: 111,271,472 R18H probably damaging Het
Mtmr14 T C 6: 113,270,512 probably benign Het
Myo15 C A 11: 60,478,977 N854K possibly damaging Het
Myo1h T C 5: 114,319,680 I84T probably benign Het
Myo9a A T 9: 59,871,100 S1380C probably benign Het
Myof A G 19: 37,981,260 V318A probably damaging Het
N4bp2l2 A G 5: 150,662,432 S28P probably damaging Het
Narfl G A 17: 25,781,821 V406M probably damaging Het
Nbr1 C T 11: 101,576,319 Q570* probably null Het
Nhp2 C T 11: 51,619,923 Q36* probably null Het
Olfr23 T G 11: 73,940,270 V8G probably benign Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Poc1b T A 10: 99,129,595 W129R probably damaging Het
Rapgef2 C T 3: 79,079,174 E1018K probably benign Het
Rgs12 T C 5: 35,024,366 probably benign Het
Rufy2 G A 10: 62,998,094 V280I probably benign Het
Snx2 A G 18: 53,210,372 I281V probably benign Het
Spag5 C A 11: 78,319,584 probably benign Het
Stxbp5 A T 10: 9,768,873 I961N probably damaging Het
Tet2 T C 3: 133,467,284 E1739G probably benign Het
Tmod2 A G 9: 75,595,055 F50S possibly damaging Het
Tnfsf13b T G 8: 10,007,166 probably null Het
Ttn T C 2: 76,786,335 K16525E possibly damaging Het
Txnrd2 T C 16: 18,440,879 probably benign Het
Ubr1 A T 2: 120,881,101 Y1437* probably null Het
Vwf C A 6: 125,566,262 D170E probably benign Het
Wdr95 C G 5: 149,574,048 I230M probably damaging Het
Xirp2 C T 2: 67,512,215 S1600F probably damaging Het
Zfp12 A G 5: 143,244,883 K322E probably damaging Het
Other mutations in Cyp2s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Cyp2s1 APN 7 25809258 missense probably damaging 1.00
IGL02415:Cyp2s1 APN 7 25808137 missense probably damaging 1.00
IGL02530:Cyp2s1 APN 7 25816424 unclassified probably benign
IGL02927:Cyp2s1 APN 7 25808152 missense probably benign 0.17
IGL03358:Cyp2s1 APN 7 25808148 missense probably damaging 1.00
R0139:Cyp2s1 UTSW 7 25811689 utr 5 prime probably null
R0523:Cyp2s1 UTSW 7 25806050 missense probably damaging 1.00
R0650:Cyp2s1 UTSW 7 25809258 missense probably damaging 1.00
R0652:Cyp2s1 UTSW 7 25809258 missense probably damaging 1.00
R1086:Cyp2s1 UTSW 7 25805997 missense probably damaging 1.00
R3732:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R3732:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R3733:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R3813:Cyp2s1 UTSW 7 25805866 splice site probably null
R3958:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R4593:Cyp2s1 UTSW 7 25816442 unclassified probably benign
R4965:Cyp2s1 UTSW 7 25809285 missense possibly damaging 0.85
R5278:Cyp2s1 UTSW 7 25805884 missense possibly damaging 0.95
R5642:Cyp2s1 UTSW 7 25816319 splice site probably null
R6258:Cyp2s1 UTSW 7 25816442 unclassified probably benign
R6628:Cyp2s1 UTSW 7 25815041 missense probably benign 0.02
R6762:Cyp2s1 UTSW 7 25808070 missense probably damaging 1.00
R7367:Cyp2s1 UTSW 7 25805973 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCACAGGAAGACAGCTCATTCCCA -3'
(R):5'- ATGCTACAACCCAAAGACAGATGTCC -3'

Sequencing Primer
(F):5'- CATTCCCAGGGTGTTTGACAG -3'
(R):5'- ctctctctctctctctctctctctc -3'
Posted On2013-07-30