Incidental Mutation 'R8210:Atg9a'
ID 636091
Institutional Source Beutler Lab
Gene Symbol Atg9a
Ensembl Gene ENSMUSG00000033124
Gene Name autophagy related 9A
Synonyms Apg9l1
MMRRC Submission 067633-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8210 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 75157509-75168654 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75161927 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 540 (T540A)
Ref Sequence ENSEMBL: ENSMUSP00000047449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027396] [ENSMUST00000040689] [ENSMUST00000186744] [ENSMUST00000188347] [ENSMUST00000189665] [ENSMUST00000189702]
AlphaFold Q68FE2
Predicted Effect probably benign
Transcript: ENSMUST00000027396
SMART Domains Protein: ENSMUSP00000027396
Gene: ENSMUSG00000026198

DomainStartEndE-ValueType
Pfam:MTABC_N 6 255 7.8e-80 PFAM
Pfam:ABC_membrane 265 544 3.7e-34 PFAM
AAA 615 816 1.29e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000040689
AA Change: T540A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124
AA Change: T540A

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186744
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000188347
AA Change: T540A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124
AA Change: T540A

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189702
AA Change: T540A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124
AA Change: T540A

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation all die within 1 day of birth and display impaired autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 G A 9: 54,517,083 (GRCm39) P577S probably damaging Het
Adal T C 2: 120,985,236 (GRCm39) V269A possibly damaging Het
Adam33 T C 2: 130,898,250 (GRCm39) T155A probably benign Het
Adgre1 A T 17: 57,752,061 (GRCm39) E603V possibly damaging Het
Adgrf4 T C 17: 42,978,441 (GRCm39) T301A probably damaging Het
Agtpbp1 G T 13: 59,630,385 (GRCm39) A782E possibly damaging Het
Ank3 A T 10: 69,811,925 (GRCm39) K1197N possibly damaging Het
Anxa9 A T 3: 95,213,207 (GRCm39) D46E probably damaging Het
Bltp1 A C 3: 37,067,030 (GRCm39) E73A Het
Cd300c2 C T 11: 114,891,634 (GRCm39) G80D possibly damaging Het
Cebpz T C 17: 79,230,685 (GRCm39) E844G probably benign Het
Celsr1 T C 15: 85,863,436 (GRCm39) I1199V probably benign Het
Cftr A G 6: 18,220,696 (GRCm39) N189S probably damaging Het
Dhrs13 G T 11: 77,924,302 (GRCm39) R116I unknown Het
Dnah10 A G 5: 124,827,858 (GRCm39) M735V probably benign Het
Dnajb8 C T 6: 88,199,940 (GRCm39) R159C possibly damaging Het
E130208F15Rik C A 7: 30,021,619 (GRCm39) S93* probably null Het
E330034G19Rik T C 14: 24,346,104 (GRCm39) I92T Het
Eef1d A T 15: 75,768,309 (GRCm39) V511D probably damaging Het
Efna1 T G 3: 89,183,520 (GRCm39) E102A probably damaging Het
H2-M11 C A 17: 36,858,860 (GRCm39) F133L probably damaging Het
Htr3b G T 9: 48,847,343 (GRCm39) probably null Het
Kcns3 A G 12: 11,142,253 (GRCm39) S149P probably damaging Het
Lhx4 T A 1: 155,586,214 (GRCm39) probably null Het
Lrp1 C T 10: 127,412,354 (GRCm39) V1317M probably damaging Het
Mphosph9 A G 5: 124,405,174 (GRCm39) I799T probably damaging Het
Muc1 C T 3: 89,138,906 (GRCm39) A505V probably damaging Het
Muc6 C A 7: 141,235,673 (GRCm39) probably null Het
Mylk A G 16: 34,820,721 (GRCm39) D1891G probably damaging Het
Nfe2l3 A T 6: 51,428,065 (GRCm39) H209L probably benign Het
Nprl2 A C 9: 107,421,947 (GRCm39) Y241S probably damaging Het
Oprm1 A T 10: 6,780,442 (GRCm39) Q368L probably benign Het
Or4g7 T A 2: 111,309,753 (GRCm39) M208K possibly damaging Het
Pcm1 C T 8: 41,766,974 (GRCm39) R1593C probably damaging Het
Pitpnm1 T C 19: 4,162,878 (GRCm39) probably null Het
Pnoc A G 14: 65,642,521 (GRCm39) S81P probably benign Het
Prkg2 T A 5: 99,114,393 (GRCm39) D585V probably damaging Het
Prpf38b A T 3: 108,815,148 (GRCm39) probably benign Het
Ranbp3l G T 15: 9,065,059 (GRCm39) S482I probably benign Het
Rapgef4 T C 2: 72,056,364 (GRCm39) F651L probably benign Het
Rasgrf1 A G 9: 89,793,675 (GRCm39) T151A unknown Het
Rnf215 T C 11: 4,085,544 (GRCm39) L91P possibly damaging Het
Rph3a T C 5: 121,099,312 (GRCm39) H193R probably benign Het
Rps17 C T 7: 80,994,750 (GRCm39) V4I probably benign Het
Sec61a2 A T 2: 5,881,728 (GRCm39) F234Y possibly damaging Het
Serpinb8 T C 1: 107,526,736 (GRCm39) L92P probably damaging Het
Slc1a6 A T 10: 78,632,091 (GRCm39) I306F possibly damaging Het
Slc26a11 T C 11: 119,270,692 (GRCm39) V538A possibly damaging Het
Slc27a1 G A 8: 72,032,566 (GRCm39) S193N probably benign Het
Slc9b1 T C 3: 135,097,948 (GRCm39) S393P probably damaging Het
Slfn3 T A 11: 83,105,332 (GRCm39) I320K possibly damaging Het
Spata31f1a T A 4: 42,848,542 (GRCm39) M1205L probably benign Het
Tgfbr1 A T 4: 47,406,924 (GRCm39) I420F probably benign Het
Tnik A T 3: 28,658,482 (GRCm39) D589V possibly damaging Het
Trappc8 A C 18: 21,006,938 (GRCm39) probably null Het
Ttbk1 A G 17: 46,791,087 (GRCm39) S66P possibly damaging Het
Unc13c A G 9: 73,392,220 (GRCm39) V2044A probably benign Het
Usp53 T C 3: 122,741,045 (GRCm39) E735G probably benign Het
Vmn2r-ps158 T A 7: 42,673,462 (GRCm39) N180K probably benign Het
Zfyve26 A T 12: 79,302,037 (GRCm39) V1853D probably damaging Het
Zkscan17 A G 11: 59,394,574 (GRCm39) V9A probably damaging Het
Other mutations in Atg9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Atg9a APN 1 75,167,010 (GRCm39) missense probably damaging 1.00
IGL02041:Atg9a APN 1 75,159,748 (GRCm39) missense possibly damaging 0.47
IGL03367:Atg9a APN 1 75,164,601 (GRCm39) missense probably benign 0.18
PIT4494001:Atg9a UTSW 1 75,164,597 (GRCm39) nonsense probably null
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0408:Atg9a UTSW 1 75,161,939 (GRCm39) missense probably damaging 1.00
R0520:Atg9a UTSW 1 75,163,178 (GRCm39) nonsense probably null
R0653:Atg9a UTSW 1 75,166,972 (GRCm39) missense probably damaging 0.96
R0666:Atg9a UTSW 1 75,161,734 (GRCm39) missense probably damaging 0.99
R0961:Atg9a UTSW 1 75,163,390 (GRCm39) missense probably damaging 0.99
R1489:Atg9a UTSW 1 75,162,734 (GRCm39) missense probably damaging 1.00
R1490:Atg9a UTSW 1 75,162,389 (GRCm39) missense possibly damaging 0.70
R1692:Atg9a UTSW 1 75,166,999 (GRCm39) missense probably benign 0.04
R1997:Atg9a UTSW 1 75,166,270 (GRCm39) missense probably benign 0.33
R2005:Atg9a UTSW 1 75,162,635 (GRCm39) missense probably benign 0.18
R2172:Atg9a UTSW 1 75,162,329 (GRCm39) missense probably damaging 0.99
R4004:Atg9a UTSW 1 75,163,095 (GRCm39) missense probably damaging 1.00
R4105:Atg9a UTSW 1 75,162,603 (GRCm39) missense probably damaging 1.00
R5010:Atg9a UTSW 1 75,162,704 (GRCm39) splice site probably null
R5220:Atg9a UTSW 1 75,162,372 (GRCm39) missense probably damaging 1.00
R5898:Atg9a UTSW 1 75,162,916 (GRCm39) missense probably damaging 1.00
R6295:Atg9a UTSW 1 75,161,702 (GRCm39) missense probably benign 0.01
R6390:Atg9a UTSW 1 75,164,625 (GRCm39) missense probably damaging 1.00
R7312:Atg9a UTSW 1 75,164,736 (GRCm39) missense probably damaging 1.00
R7729:Atg9a UTSW 1 75,161,204 (GRCm39) missense probably benign 0.34
R8111:Atg9a UTSW 1 75,164,366 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,163,009 (GRCm39) missense probably damaging 1.00
R8256:Atg9a UTSW 1 75,163,563 (GRCm39) missense possibly damaging 0.88
R8319:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8321:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8382:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8406:Atg9a UTSW 1 75,167,028 (GRCm39) missense probably damaging 1.00
R8482:Atg9a UTSW 1 75,162,870 (GRCm39) missense probably damaging 0.99
R8855:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R8866:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R9381:Atg9a UTSW 1 75,162,726 (GRCm39) missense probably benign
R9441:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9442:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9448:Atg9a UTSW 1 75,162,849 (GRCm39) missense probably benign 0.35
R9608:Atg9a UTSW 1 75,161,739 (GRCm39) missense possibly damaging 0.52
R9703:Atg9a UTSW 1 75,162,431 (GRCm39) missense probably damaging 0.98
RF021:Atg9a UTSW 1 75,159,273 (GRCm39) missense probably damaging 0.96
Z1176:Atg9a UTSW 1 75,163,203 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGACTCAGACTGTAAGGAC -3'
(R):5'- AAAAGTACAGTTCAAGTGACTGACC -3'

Sequencing Primer
(F):5'- CTCAGACTGTAAGGACTGGATG -3'
(R):5'- CAGTTCAAGTGACTGACCCAGTATG -3'
Posted On 2020-07-13