Incidental Mutation 'R8210:Unc13c'
ID636122
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Nameunc-13 homolog C (C. elegans)
SynonymsMunc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8210 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location73479422-73968966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73484938 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2044 (V2044A)
Ref Sequence ENSEMBL: ENSMUSP00000074726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
Predicted Effect probably benign
Transcript: ENSMUST00000075245
AA Change: V2044A

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: V2044A

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184666
AA Change: V2044A

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: V2044A

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Meta Mutation Damage Score 0.3267 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 37,012,881 E73A Het
Acsbg1 G A 9: 54,609,799 P577S probably damaging Het
Adal T C 2: 121,154,755 V269A possibly damaging Het
Adam33 T C 2: 131,056,330 T155A probably benign Het
Adgre1 A T 17: 57,445,061 E603V possibly damaging Het
Adgrf4 T C 17: 42,667,550 T301A probably damaging Het
Agtpbp1 G T 13: 59,482,571 A782E possibly damaging Het
Ank3 A T 10: 69,976,095 K1197N possibly damaging Het
Anxa9 A T 3: 95,305,896 D46E probably damaging Het
Atg9a T C 1: 75,185,283 T540A probably damaging Het
Atg9a A G 1: 75,186,365 Y364H probably damaging Het
Cd300c2 C T 11: 115,000,808 G80D possibly damaging Het
Cebpz T C 17: 78,923,256 E844G probably benign Het
Celsr1 T C 15: 85,979,235 I1199V probably benign Het
Cftr A G 6: 18,220,697 N189S probably damaging Het
Dhrs13 G T 11: 78,033,476 R116I unknown Het
Dnah10 A G 5: 124,750,794 M735V probably benign Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
E130208F15Rik C A 7: 30,322,194 S93* probably null Het
E330034G19Rik T C 14: 24,296,036 I92T Het
Eef1d A T 15: 75,896,460 V511D probably damaging Het
Efna1 T G 3: 89,276,213 E102A probably damaging Het
Fam205a1 T A 4: 42,848,542 M1205L probably benign Het
Gm9268 T A 7: 43,024,038 N180K probably benign Het
H2-M11 C A 17: 36,547,968 F133L probably damaging Het
Htr3b G T 9: 48,936,043 probably null Het
Kcns3 A G 12: 11,092,252 S149P probably damaging Het
Lhx4 T A 1: 155,710,468 probably null Het
Lrp1 C T 10: 127,576,485 V1317M probably damaging Het
Mphosph9 A G 5: 124,267,111 I799T probably damaging Het
Muc1 C T 3: 89,231,599 A505V probably damaging Het
Muc6 C A 7: 141,649,408 probably null Het
Mylk A G 16: 35,000,351 D1891G probably damaging Het
Nfe2l3 A T 6: 51,451,085 H209L probably benign Het
Nprl2 A C 9: 107,544,748 Y241S probably damaging Het
Olfr1288 T A 2: 111,479,408 M208K possibly damaging Het
Oprm1 A T 10: 6,830,442 Q368L probably benign Het
Pcm1 C T 8: 41,313,937 R1593C probably damaging Het
Pitpnm1 T C 19: 4,112,878 probably null Het
Pnoc A G 14: 65,405,072 S81P probably benign Het
Prkg2 T A 5: 98,966,534 D585V probably damaging Het
Prpf38b A T 3: 108,907,832 probably benign Het
Ranbp3l G T 15: 9,064,979 S482I probably benign Het
Rapgef4 T C 2: 72,226,020 F651L probably benign Het
Rasgrf1 A G 9: 89,911,622 T151A unknown Het
Rnf215 T C 11: 4,135,544 L91P possibly damaging Het
Rph3a T C 5: 120,961,249 H193R probably benign Het
Rps17 C T 7: 81,345,002 V4I probably benign Het
Sec61a2 A T 2: 5,876,917 F234Y possibly damaging Het
Serpinb8 T C 1: 107,599,006 L92P probably damaging Het
Slc1a6 A T 10: 78,796,257 I306F possibly damaging Het
Slc26a11 T C 11: 119,379,866 V538A possibly damaging Het
Slc27a1 G A 8: 71,579,922 S193N probably benign Het
Slc9b1 T C 3: 135,392,187 S393P probably damaging Het
Slfn3 T A 11: 83,214,506 I320K possibly damaging Het
Tgfbr1 A T 4: 47,406,924 I420F probably benign Het
Tnik A T 3: 28,604,333 D589V possibly damaging Het
Trappc8 A C 18: 20,873,881 probably null Het
Ttbk1 A G 17: 46,480,161 S66P possibly damaging Het
Usp53 T C 3: 122,947,396 E735G probably benign Het
Zfyve26 A T 12: 79,255,263 V1853D probably damaging Het
Zkscan17 A G 11: 59,503,748 V9A probably damaging Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73736703 missense probably damaging 0.99
IGL00693:Unc13c APN 9 73758602 missense probably benign 0.18
IGL01022:Unc13c APN 9 73517328 missense probably benign 0.06
IGL01088:Unc13c APN 9 73932281 missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73933197 missense probably benign 0.05
IGL01131:Unc13c APN 9 73564053 missense probably benign
IGL01135:Unc13c APN 9 73484893 missense probably damaging 1.00
IGL01393:Unc13c APN 9 73540270 missense probably benign 0.06
IGL01752:Unc13c APN 9 73931811 missense probably benign 0.01
IGL01893:Unc13c APN 9 73693366 missense probably benign 0.15
IGL01897:Unc13c APN 9 73546027 missense probably damaging 0.99
IGL01936:Unc13c APN 9 73693242 missense probably benign 0.07
IGL02122:Unc13c APN 9 73734397 splice site probably benign
IGL02341:Unc13c APN 9 73933210 missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73932628 missense probably benign 0.01
IGL02545:Unc13c APN 9 73481075 missense probably damaging 0.98
IGL02709:Unc13c APN 9 73558956 missense probably benign 0.00
IGL02815:Unc13c APN 9 73540263 missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73481067 nonsense probably null
IGL03117:Unc13c APN 9 73534025 missense probably benign 0.03
IGL03260:Unc13c APN 9 73931344 missense probably benign 0.11
feeling UTSW 9 73693271 missense possibly damaging 0.46
Inkling UTSW 9 73931844 missense probably damaging 1.00
notion UTSW 9 73736562 missense probably damaging 1.00
BB001:Unc13c UTSW 9 73734408 missense probably benign 0.05
BB011:Unc13c UTSW 9 73734408 missense probably benign 0.05
PIT4431001:Unc13c UTSW 9 73749547 missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73483739 missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73693301 missense probably benign 0.07
R0039:Unc13c UTSW 9 73669565 splice site probably benign
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0308:Unc13c UTSW 9 73481118 missense probably benign 0.04
R0344:Unc13c UTSW 9 73930785 missense probably benign 0.39
R0421:Unc13c UTSW 9 73933210 missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73530983 splice site probably benign
R0655:Unc13c UTSW 9 73930953 missense probably damaging 0.96
R1013:Unc13c UTSW 9 73933332 missense probably benign 0.45
R1293:Unc13c UTSW 9 73574074 missense probably benign 0.06
R1493:Unc13c UTSW 9 73639068 missense probably benign 0.27
R1675:Unc13c UTSW 9 73639050 critical splice donor site probably null
R1789:Unc13c UTSW 9 73756339 missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73483615 splice site probably null
R2055:Unc13c UTSW 9 73736550 missense probably damaging 1.00
R2060:Unc13c UTSW 9 73665656 missense probably damaging 0.99
R2420:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2421:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2422:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R3415:Unc13c UTSW 9 73932586 missense probably benign 0.00
R3423:Unc13c UTSW 9 73930653 missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73930958 missense probably benign 0.00
R3857:Unc13c UTSW 9 73699108 nonsense probably null
R3859:Unc13c UTSW 9 73699108 nonsense probably null
R3895:Unc13c UTSW 9 73933523 missense probably benign
R4038:Unc13c UTSW 9 73533906 critical splice donor site probably null
R4077:Unc13c UTSW 9 73736539 nonsense probably null
R4125:Unc13c UTSW 9 73574007 critical splice donor site probably null
R4128:Unc13c UTSW 9 73734537 missense probably damaging 1.00
R4235:Unc13c UTSW 9 73530952 missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73734504 missense probably damaging 1.00
R4307:Unc13c UTSW 9 73693367 missense probably benign 0.06
R4658:Unc13c UTSW 9 73932826 missense probably damaging 1.00
R4694:Unc13c UTSW 9 73572354 missense probably benign 0.00
R4735:Unc13c UTSW 9 73693338 missense probably benign 0.00
R4744:Unc13c UTSW 9 73931844 missense probably damaging 1.00
R4795:Unc13c UTSW 9 73932187 missense probably damaging 0.97
R4827:Unc13c UTSW 9 73931286 missense probably damaging 1.00
R4838:Unc13c UTSW 9 73932072 missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73680434 missense probably benign 0.02
R4873:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4875:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4876:Unc13c UTSW 9 73749539 missense probably damaging 1.00
R4905:Unc13c UTSW 9 73680392 missense probably benign
R4912:Unc13c UTSW 9 73574022 missense probably damaging 0.99
R5026:Unc13c UTSW 9 73930903 missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73933372 missense probably benign 0.26
R5151:Unc13c UTSW 9 73931475 missense probably benign 0.02
R5171:Unc13c UTSW 9 73757954 missense probably benign
R5244:Unc13c UTSW 9 73525951 critical splice donor site probably null
R5342:Unc13c UTSW 9 73930823 missense probably benign 0.00
R5399:Unc13c UTSW 9 73749688 missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73578390 missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73545989 missense probably benign
R5680:Unc13c UTSW 9 73932602 missense probably damaging 1.00
R5681:Unc13c UTSW 9 73546075 splice site probably null
R5728:Unc13c UTSW 9 73558956 missense probably benign 0.01
R5762:Unc13c UTSW 9 73812367 missense probably benign 0.00
R5764:Unc13c UTSW 9 73533903 splice site probably null
R5829:Unc13c UTSW 9 73693368 missense probably benign 0.15
R5894:Unc13c UTSW 9 73693204 critical splice donor site probably null
R5936:Unc13c UTSW 9 73578492 missense probably damaging 1.00
R6043:Unc13c UTSW 9 73736651 missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73930884 missense probably benign
R6148:Unc13c UTSW 9 73693366 missense probably benign 0.15
R6207:Unc13c UTSW 9 73758628 missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73699169 missense probably damaging 1.00
R6338:Unc13c UTSW 9 73734447 missense probably damaging 0.99
R6615:Unc13c UTSW 9 73930608 missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73931977 missense probably benign 0.39
R7053:Unc13c UTSW 9 73932297 missense probably damaging 1.00
R7223:Unc13c UTSW 9 73629191 missense probably benign 0.44
R7259:Unc13c UTSW 9 73517363 missense probably benign 0.00
R7353:Unc13c UTSW 9 73574073 missense probably benign 0.00
R7357:Unc13c UTSW 9 73933528 small insertion probably benign
R7357:Unc13c UTSW 9 73933529 small insertion probably benign
R7607:Unc13c UTSW 9 73669535 missense probably damaging 0.98
R7626:Unc13c UTSW 9 73734517 missense probably damaging 1.00
R7639:Unc13c UTSW 9 73933168 missense probably damaging 0.99
R7657:Unc13c UTSW 9 73533903 splice site probably null
R7665:Unc13c UTSW 9 73680474 missense probably benign 0.28
R7704:Unc13c UTSW 9 73699212 missense probably benign 0.27
R7776:Unc13c UTSW 9 73694950 missense probably damaging 1.00
R7811:Unc13c UTSW 9 73693271 missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R7924:Unc13c UTSW 9 73734408 missense probably benign 0.05
R8047:Unc13c UTSW 9 73812354 nonsense probably null
R8167:Unc13c UTSW 9 73736703 missense probably damaging 0.99
R8202:Unc13c UTSW 9 73736562 missense probably damaging 1.00
R8352:Unc13c UTSW 9 73931008 missense probably damaging 0.99
R8368:Unc13c UTSW 9 73930788 missense probably benign 0.15
R8452:Unc13c UTSW 9 73931008 missense probably damaging 0.99
R8535:Unc13c UTSW 9 73540371 missense probably benign
R8677:Unc13c UTSW 9 73932961 missense probably benign 0.00
R8700:Unc13c UTSW 9 73572397 missense probably benign 0.44
R8848:Unc13c UTSW 9 73525981 missense probably benign
R8902:Unc13c UTSW 9 73749548 missense probably damaging 0.97
R8953:Unc13c UTSW 9 73932762 missense probably benign 0.00
R8961:Unc13c UTSW 9 73932242 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACCTTTCAGTTGGAAAACAGGG -3'
(R):5'- TAAACTCTGTGAGCACTGATCAG -3'

Sequencing Primer
(F):5'- CAGTTGGAAAACAGGGTTCATTTG -3'
(R):5'- ACTGATCAGTGTCCAACATGAG -3'
Posted On2020-07-13