Incidental Mutation 'R8210:Ttbk1'
ID636146
Institutional Source Beutler Lab
Gene Symbol Ttbk1
Ensembl Gene ENSMUSG00000015599
Gene Nametau tubulin kinase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R8210 (G1)
Quality Score195.009
Status Validated
Chromosome17
Chromosomal Location46442448-46487675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46480161 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 66 (S66P)
Ref Sequence ENSEMBL: ENSMUSP00000044580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047034]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047034
AA Change: S66P

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044580
Gene: ENSMUSG00000015599
AA Change: S66P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 34 293 3.4e-21 PFAM
Pfam:Pkinase 34 305 1.7e-33 PFAM
low complexity region 320 334 N/A INTRINSIC
low complexity region 371 395 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
low complexity region 611 624 N/A INTRINSIC
low complexity region 633 653 N/A INTRINSIC
low complexity region 697 709 N/A INTRINSIC
coiled coil region 729 776 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 893 913 N/A INTRINSIC
low complexity region 945 962 N/A INTRINSIC
low complexity region 1090 1115 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary:This gene belongs to the casein kinase 1 superfamily. The encoded protein is a neuron-specific, serine/threonine and tyrosine kinase, which regulates phosphorylation of tau, a protein that associates with microtubule assemblies and stabilizes them. Genetic variants in this gene are associated with Alzheimer's disease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 37,012,881 E73A Het
Acsbg1 G A 9: 54,609,799 P577S probably damaging Het
Adal T C 2: 121,154,755 V269A possibly damaging Het
Adam33 T C 2: 131,056,330 T155A probably benign Het
Adgre1 A T 17: 57,445,061 E603V possibly damaging Het
Adgrf4 T C 17: 42,667,550 T301A probably damaging Het
Agtpbp1 G T 13: 59,482,571 A782E possibly damaging Het
Ank3 A T 10: 69,976,095 K1197N possibly damaging Het
Anxa9 A T 3: 95,305,896 D46E probably damaging Het
Atg9a T C 1: 75,185,283 T540A probably damaging Het
Atg9a A G 1: 75,186,365 Y364H probably damaging Het
Cd300c2 C T 11: 115,000,808 G80D possibly damaging Het
Cebpz T C 17: 78,923,256 E844G probably benign Het
Celsr1 T C 15: 85,979,235 I1199V probably benign Het
Cftr A G 6: 18,220,697 N189S probably damaging Het
Dhrs13 G T 11: 78,033,476 R116I unknown Het
Dnah10 A G 5: 124,750,794 M735V probably benign Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
E130208F15Rik C A 7: 30,322,194 S93* probably null Het
E330034G19Rik T C 14: 24,296,036 I92T Het
Eef1d A T 15: 75,896,460 V511D probably damaging Het
Efna1 T G 3: 89,276,213 E102A probably damaging Het
Fam205a1 T A 4: 42,848,542 M1205L probably benign Het
Gm9268 T A 7: 43,024,038 N180K probably benign Het
H2-M11 C A 17: 36,547,968 F133L probably damaging Het
Htr3b G T 9: 48,936,043 probably null Het
Kcns3 A G 12: 11,092,252 S149P probably damaging Het
Lhx4 T A 1: 155,710,468 probably null Het
Lrp1 C T 10: 127,576,485 V1317M probably damaging Het
Mphosph9 A G 5: 124,267,111 I799T probably damaging Het
Muc1 C T 3: 89,231,599 A505V probably damaging Het
Muc6 C A 7: 141,649,408 probably null Het
Mylk A G 16: 35,000,351 D1891G probably damaging Het
Nfe2l3 A T 6: 51,451,085 H209L probably benign Het
Nprl2 A C 9: 107,544,748 Y241S probably damaging Het
Olfr1288 T A 2: 111,479,408 M208K possibly damaging Het
Oprm1 A T 10: 6,830,442 Q368L probably benign Het
Pcm1 C T 8: 41,313,937 R1593C probably damaging Het
Pitpnm1 T C 19: 4,112,878 probably null Het
Pnoc A G 14: 65,405,072 S81P probably benign Het
Prkg2 T A 5: 98,966,534 D585V probably damaging Het
Prpf38b A T 3: 108,907,832 probably benign Het
Ranbp3l G T 15: 9,064,979 S482I probably benign Het
Rapgef4 T C 2: 72,226,020 F651L probably benign Het
Rasgrf1 A G 9: 89,911,622 T151A unknown Het
Rnf215 T C 11: 4,135,544 L91P possibly damaging Het
Rph3a T C 5: 120,961,249 H193R probably benign Het
Rps17 C T 7: 81,345,002 V4I probably benign Het
Sec61a2 A T 2: 5,876,917 F234Y possibly damaging Het
Serpinb8 T C 1: 107,599,006 L92P probably damaging Het
Slc1a6 A T 10: 78,796,257 I306F possibly damaging Het
Slc26a11 T C 11: 119,379,866 V538A possibly damaging Het
Slc27a1 G A 8: 71,579,922 S193N probably benign Het
Slc9b1 T C 3: 135,392,187 S393P probably damaging Het
Slfn3 T A 11: 83,214,506 I320K possibly damaging Het
Tgfbr1 A T 4: 47,406,924 I420F probably benign Het
Tnik A T 3: 28,604,333 D589V possibly damaging Het
Trappc8 A C 18: 20,873,881 probably null Het
Unc13c A G 9: 73,484,938 V2044A probably benign Het
Usp53 T C 3: 122,947,396 E735G probably benign Het
Zfyve26 A T 12: 79,255,263 V1853D probably damaging Het
Zkscan17 A G 11: 59,503,748 V9A probably damaging Het
Other mutations in Ttbk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Ttbk1 APN 17 46447063 missense probably damaging 1.00
IGL02469:Ttbk1 APN 17 46470630 missense possibly damaging 0.77
IGL02826:Ttbk1 APN 17 46470660 missense probably benign
IGL02874:Ttbk1 APN 17 46470225 missense probably benign 0.10
IGL02948:Ttbk1 APN 17 46446330 missense probably benign 0.44
IGL03037:Ttbk1 APN 17 46446330 missense probably benign 0.44
R0165:Ttbk1 UTSW 17 46478938 missense possibly damaging 0.70
R1186:Ttbk1 UTSW 17 46467131 missense probably damaging 1.00
R1228:Ttbk1 UTSW 17 46476712 critical splice donor site probably null
R1423:Ttbk1 UTSW 17 46446154 splice site probably benign
R1477:Ttbk1 UTSW 17 46476799 missense probably benign 0.05
R1960:Ttbk1 UTSW 17 46480224 missense probably damaging 0.99
R1961:Ttbk1 UTSW 17 46480224 missense probably damaging 0.99
R4043:Ttbk1 UTSW 17 46446762 missense probably benign 0.21
R4190:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4192:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4193:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4660:Ttbk1 UTSW 17 46477788 nonsense probably null
R5383:Ttbk1 UTSW 17 46467416 missense probably damaging 1.00
R5385:Ttbk1 UTSW 17 46447632 missense probably benign 0.00
R5715:Ttbk1 UTSW 17 46479207 missense probably damaging 0.99
R6218:Ttbk1 UTSW 17 46470807 missense possibly damaging 0.47
R6263:Ttbk1 UTSW 17 46467262 missense probably damaging 1.00
R6471:Ttbk1 UTSW 17 46467277 missense probably benign
R6537:Ttbk1 UTSW 17 46470310 missense probably damaging 0.98
R6552:Ttbk1 UTSW 17 46478962 missense probably benign 0.14
R7564:Ttbk1 UTSW 17 46476931 missense possibly damaging 0.66
R7853:Ttbk1 UTSW 17 46447343 missense probably benign 0.00
R7871:Ttbk1 UTSW 17 46446238 missense probably benign
R7873:Ttbk1 UTSW 17 46446568 missense probably damaging 1.00
R7908:Ttbk1 UTSW 17 46478938 missense probably damaging 1.00
R8236:Ttbk1 UTSW 17 46470729 missense probably damaging 1.00
R8754:Ttbk1 UTSW 17 46445201 nonsense probably null
R8829:Ttbk1 UTSW 17 46446895 missense probably damaging 1.00
R8870:Ttbk1 UTSW 17 46470735 missense probably damaging 1.00
X0066:Ttbk1 UTSW 17 46446856 missense possibly damaging 0.74
Z1088:Ttbk1 UTSW 17 46446325 missense probably benign 0.35
Z1176:Ttbk1 UTSW 17 46460911 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CTGCCCATGATCCAGTTCAC -3'
(R):5'- TCTGTTTCAGAGGAGAGAAGCG -3'

Sequencing Primer
(F):5'- CTCTGCCATCACTAGCACAGGG -3'
(R):5'- TGACACACCTGCCTGTCAGTG -3'
Posted On2020-07-13