Incidental Mutation 'R8211:Ikbke'
ID636152
Institutional Source Beutler Lab
Gene Symbol Ikbke
Ensembl Gene ENSMUSG00000042349
Gene Nameinhibitor of kappaB kinase epsilon
SynonymsIKK-i, IKKepsilon
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8211 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location131254343-131279606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131271778 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 326 (I326T)
Ref Sequence ENSEMBL: ENSMUSP00000054126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062108] [ENSMUST00000159195] [ENSMUST00000161764]
Predicted Effect probably damaging
Transcript: ENSMUST00000062108
AA Change: I326T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000054126
Gene: ENSMUSG00000042349
AA Change: I326T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 249 1.1e-29 PFAM
Pfam:Pkinase 9 301 6.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159195
SMART Domains Protein: ENSMUSP00000124486
Gene: ENSMUSG00000042349

DomainStartEndE-ValueType
Pfam:Pkinase 9 130 2.2e-23 PFAM
Pfam:Pkinase_Tyr 9 130 2.1e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161764
AA Change: I302T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124190
Gene: ENSMUSG00000042349
AA Change: I302T

DomainStartEndE-ValueType
Pfam:Pkinase 49 278 9.3e-31 PFAM
Pfam:Pkinase_Tyr 50 226 5.7e-17 PFAM
Meta Mutation Damage Score 0.2064 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IKBKE is a noncanonical I-kappa-B (see MIM 164008) kinase (IKK) that is essential for regulating antiviral signaling pathways. IKBKE has also been identified as a breast cancer (MIM 114480) oncogene and is amplified and overexpressed in over 30% of breast carcinomas and breast cancer cell lines (Hutti et al., 2009 [PubMed 19481526]).[supplied by OMIM, Oct 2009]
PHENOTYPE: Homozygous null mice are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,435 I28V possibly damaging Het
A330017A19Rik A G 17: 46,890,383 probably benign Het
Adamtsl3 T C 7: 82,523,163 S445P probably damaging Het
Afp T C 5: 90,501,486 I304T possibly damaging Het
Alk G A 17: 71,869,707 A1534V probably benign Het
Ank3 C T 10: 69,867,398 P287L unknown Het
Appl1 T C 14: 26,945,598 I367V probably benign Het
Arpin T A 7: 79,935,244 M1L probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
B430203G13Rik A T 12: 17,924,539 H82L noncoding transcript Het
Bcl11a T A 11: 24,078,394 S2T probably damaging Het
Cfap46 T A 7: 139,633,304 M1605L unknown Het
Chga C A 12: 102,561,419 Q111K possibly damaging Het
Drc7 A G 8: 95,056,079 E24G unknown Het
Dst T C 1: 34,212,451 L2195P probably damaging Het
Enpp5 G A 17: 44,081,511 probably null Het
Fat2 A G 11: 55,312,209 L13P possibly damaging Het
Grhl1 T C 12: 24,586,152 probably null Het
Krt26 C T 11: 99,335,284 D195N probably damaging Het
Lamc2 A T 1: 153,166,278 C37S probably damaging Het
Lrriq1 A G 10: 103,170,547 L1239P probably damaging Het
Mrps5 T A 2: 127,603,724 H390Q probably benign Het
Nphp3 T A 9: 104,031,897 C769S possibly damaging Het
Obscn A G 11: 59,115,794 S1181P probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pabpc6 G T 17: 9,669,457 A55E probably damaging Het
Pcdha9 A T 18: 36,998,859 E327V possibly damaging Het
Pds5b A G 5: 150,728,942 T225A possibly damaging Het
Pi4ka A C 16: 17,282,905 I1807S Het
Pick1 T A 15: 79,248,730 I330N probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rubcn A C 16: 32,836,543 C502W possibly damaging Het
Slc26a10 G A 10: 127,173,965 R571C probably benign Het
Slc44a2 A T 9: 21,348,138 N587Y probably damaging Het
Slfn2 T G 11: 83,069,759 V188G possibly damaging Het
Smok2b T C 17: 13,235,793 V280A probably benign Het
Snx19 A G 9: 30,437,465 E798G probably benign Het
Sspo T C 6: 48,492,609 probably null Het
Ugt2b37 T C 5: 87,242,376 I404V probably benign Het
Vmn1r160 T C 7: 22,871,326 F35L possibly damaging Het
Vmn1r193 A T 13: 22,219,116 Y235* probably null Het
Vmn2r53 T C 7: 12,581,916 I659V probably benign Het
Vmn2r91 A G 17: 18,106,500 D349G probably damaging Het
Zfp292 A T 4: 34,806,163 S2299T probably benign Het
Zfp938 T C 10: 82,226,585 N67S possibly damaging Het
Other mutations in Ikbke
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ikbke APN 1 131270012 splice site probably null
IGL00703:Ikbke APN 1 131255302 utr 3 prime probably benign
IGL01079:Ikbke APN 1 131265647 missense possibly damaging 0.64
IGL01106:Ikbke APN 1 131260055 splice site probably benign
IGL01336:Ikbke APN 1 131273756 missense probably damaging 1.00
IGL01505:Ikbke APN 1 131255311 missense probably benign 0.00
IGL01564:Ikbke APN 1 131257921 missense probably benign 0.37
IGL01568:Ikbke APN 1 131257896 splice site probably null
IGL01668:Ikbke APN 1 131256938 missense probably benign 0.05
IGL01977:Ikbke APN 1 131272101 splice site probably benign
IGL02162:Ikbke APN 1 131273715 missense possibly damaging 0.69
IGL02653:Ikbke APN 1 131271835 missense possibly damaging 0.89
IGL02859:Ikbke APN 1 131270197 missense probably damaging 0.97
triathelon UTSW 1 131275267 frame shift probably null
R0028:Ikbke UTSW 1 131272184 missense possibly damaging 0.87
R0427:Ikbke UTSW 1 131257910 missense possibly damaging 0.62
R0607:Ikbke UTSW 1 131270184 critical splice donor site probably null
R1295:Ikbke UTSW 1 131270226 missense probably benign 0.03
R1470:Ikbke UTSW 1 131276487 missense probably null 1.00
R1470:Ikbke UTSW 1 131276487 missense probably null 1.00
R1720:Ikbke UTSW 1 131259210 missense possibly damaging 0.94
R1728:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1728:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1729:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1729:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1730:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1730:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1739:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1739:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1748:Ikbke UTSW 1 131259200 missense probably benign 0.02
R1762:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1762:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1763:Ikbke UTSW 1 131265877 missense probably benign 0.01
R1783:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1783:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1784:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1784:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1785:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1785:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1794:Ikbke UTSW 1 131259218 missense probably damaging 1.00
R2143:Ikbke UTSW 1 131273474 missense probably damaging 0.98
R2144:Ikbke UTSW 1 131273474 missense probably damaging 0.98
R2145:Ikbke UTSW 1 131273474 missense probably damaging 0.98
R2386:Ikbke UTSW 1 131259266 missense probably damaging 1.00
R2893:Ikbke UTSW 1 131270224 missense probably damaging 1.00
R4210:Ikbke UTSW 1 131263348 missense probably damaging 0.97
R4211:Ikbke UTSW 1 131263348 missense probably damaging 0.97
R4284:Ikbke UTSW 1 131275778 critical splice donor site probably null
R4461:Ikbke UTSW 1 131265922 missense probably benign
R4551:Ikbke UTSW 1 131258033 intron probably benign
R4560:Ikbke UTSW 1 131272120 missense probably damaging 1.00
R4849:Ikbke UTSW 1 131275267 frame shift probably null
R4855:Ikbke UTSW 1 131257111 splice site probably null
R4876:Ikbke UTSW 1 131275267 frame shift probably null
R4879:Ikbke UTSW 1 131275267 frame shift probably null
R4967:Ikbke UTSW 1 131275267 frame shift probably null
R4968:Ikbke UTSW 1 131275267 frame shift probably null
R4971:Ikbke UTSW 1 131275267 frame shift probably null
R5020:Ikbke UTSW 1 131273660 missense probably damaging 1.00
R5699:Ikbke UTSW 1 131276467 critical splice donor site probably null
R5814:Ikbke UTSW 1 131271779 missense probably damaging 0.96
R6392:Ikbke UTSW 1 131275146 splice site probably null
R6492:Ikbke UTSW 1 131259218 missense probably damaging 1.00
R6899:Ikbke UTSW 1 131275762 missense probably damaging 1.00
R7552:Ikbke UTSW 1 131272150 nonsense probably null
R7583:Ikbke UTSW 1 131276479 missense probably damaging 0.99
R7652:Ikbke UTSW 1 131271832 missense probably damaging 1.00
R7806:Ikbke UTSW 1 131271898 missense probably damaging 1.00
R7984:Ikbke UTSW 1 131275786 missense probably null 1.00
R8309:Ikbke UTSW 1 131263328 nonsense probably null
X0026:Ikbke UTSW 1 131257986 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCAGCTAGCATTGGGAAG -3'
(R):5'- GTTCCATCTAGACGCTTGGG -3'

Sequencing Primer
(F):5'- CATTGGGAAGAGTGGGGGATTC -3'
(R):5'- GCTCTGACAGTCCTCGTG -3'
Posted On2020-07-13