Incidental Mutation 'R8211:Mrps5'
ID 636155
Institutional Source Beutler Lab
Gene Symbol Mrps5
Ensembl Gene ENSMUSG00000027374
Gene Name mitochondrial ribosomal protein S5
Synonyms
MMRRC Submission 067634-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8211 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 127587222-127606829 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127603724 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 390 (H390Q)
Ref Sequence ENSEMBL: ENSMUSP00000028852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028852]
AlphaFold Q99N87
Predicted Effect probably benign
Transcript: ENSMUST00000028852
AA Change: H390Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028852
Gene: ENSMUSG00000027374
AA Change: H390Q

DomainStartEndE-ValueType
low complexity region 108 126 N/A INTRINSIC
Pfam:Ribosomal_S5 220 285 3.5e-20 PFAM
Pfam:Ribosomal_S5_C 297 368 4.7e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S5P family. Pseudogenes corresponding to this gene are found on chromosomes 4q, 5q, and 18q. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,435 I28V possibly damaging Het
A330017A19Rik A G 17: 46,890,383 probably benign Het
Adamtsl3 T C 7: 82,523,163 S445P probably damaging Het
Afp T C 5: 90,501,486 I304T possibly damaging Het
Alk G A 17: 71,869,707 A1534V probably benign Het
Ank3 C T 10: 69,867,398 P287L unknown Het
Appl1 T C 14: 26,945,598 I367V probably benign Het
Arpin T A 7: 79,935,244 M1L probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
B430203G13Rik A T 12: 17,924,539 H82L noncoding transcript Het
Bcl11a T A 11: 24,078,394 S2T probably damaging Het
Cfap46 T A 7: 139,633,304 M1605L unknown Het
Chga C A 12: 102,561,419 Q111K possibly damaging Het
Drc7 A G 8: 95,056,079 E24G unknown Het
Dst T C 1: 34,212,451 L2195P probably damaging Het
Enpp5 G A 17: 44,081,511 probably null Het
Fat2 A G 11: 55,312,209 L13P possibly damaging Het
Grhl1 T C 12: 24,586,152 probably null Het
Ikbke A G 1: 131,271,778 I326T probably damaging Het
Krt26 C T 11: 99,335,284 D195N probably damaging Het
Lamc2 A T 1: 153,166,278 C37S probably damaging Het
Lrriq1 A G 10: 103,170,547 L1239P probably damaging Het
Nphp3 T A 9: 104,031,897 C769S possibly damaging Het
Obscn A G 11: 59,115,794 S1181P probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pabpc6 G T 17: 9,669,457 A55E probably damaging Het
Pcdha9 A T 18: 36,998,859 E327V possibly damaging Het
Pds5b A G 5: 150,728,942 T225A possibly damaging Het
Pi4ka A C 16: 17,282,905 I1807S Het
Pick1 T A 15: 79,248,730 I330N probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rubcn A C 16: 32,836,543 C502W possibly damaging Het
Slc26a10 G A 10: 127,173,965 R571C probably benign Het
Slc44a2 A T 9: 21,348,138 N587Y probably damaging Het
Slfn2 T G 11: 83,069,759 V188G possibly damaging Het
Smok2b T C 17: 13,235,793 V280A probably benign Het
Snx19 A G 9: 30,437,465 E798G probably benign Het
Sspo T C 6: 48,492,609 probably null Het
Ugt2b37 T C 5: 87,242,376 I404V probably benign Het
Vmn1r160 T C 7: 22,871,326 F35L possibly damaging Het
Vmn1r193 A T 13: 22,219,116 Y235* probably null Het
Vmn2r53 T C 7: 12,581,916 I659V probably benign Het
Vmn2r91 A G 17: 18,106,500 D349G probably damaging Het
Zfp292 A T 4: 34,806,163 S2299T probably benign Het
Zfp938 T C 10: 82,226,585 N67S possibly damaging Het
Other mutations in Mrps5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01968:Mrps5 APN 2 127591907 missense probably null 0.01
IGL03348:Mrps5 APN 2 127601385 missense probably damaging 0.98
R0369:Mrps5 UTSW 2 127591829 missense probably benign 0.09
R0485:Mrps5 UTSW 2 127591825 missense possibly damaging 0.56
R0622:Mrps5 UTSW 2 127594531 missense probably benign 0.00
R1954:Mrps5 UTSW 2 127596897 splice site probably null
R2182:Mrps5 UTSW 2 127602487 missense probably damaging 1.00
R3414:Mrps5 UTSW 2 127596912 missense probably benign 0.38
R4007:Mrps5 UTSW 2 127591835 missense possibly damaging 0.81
R4687:Mrps5 UTSW 2 127590770 missense probably benign 0.44
R4780:Mrps5 UTSW 2 127598241 missense probably benign 0.00
R4835:Mrps5 UTSW 2 127603707 missense possibly damaging 0.84
R4851:Mrps5 UTSW 2 127590745 missense probably benign 0.00
R5076:Mrps5 UTSW 2 127600852 nonsense probably null
R5558:Mrps5 UTSW 2 127602435 missense probably damaging 1.00
R6192:Mrps5 UTSW 2 127601385 missense probably damaging 0.98
R7038:Mrps5 UTSW 2 127600866 missense probably damaging 1.00
R7071:Mrps5 UTSW 2 127600852 nonsense probably null
R7103:Mrps5 UTSW 2 127601410 missense probably damaging 0.99
R7177:Mrps5 UTSW 2 127595697 missense probably benign
R7319:Mrps5 UTSW 2 127595842 missense possibly damaging 0.94
R7387:Mrps5 UTSW 2 127600884 missense probably damaging 1.00
R7460:Mrps5 UTSW 2 127591891 missense not run
R9052:Mrps5 UTSW 2 127591956 splice site probably benign
R9358:Mrps5 UTSW 2 127595814 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ATCTCAGGGCTCTTGATGCTG -3'
(R):5'- AAAGTGAGAGTGGCGTGTCC -3'

Sequencing Primer
(F):5'- GCTTCCTTTGAGTTGACAGAAGCC -3'
(R):5'- TCCTCCGGGTGCTGTCAG -3'
Posted On 2020-07-13