Incidental Mutation 'R8211:Pds5b'
ID636161
Institutional Source Beutler Lab
Gene Symbol Pds5b
Ensembl Gene ENSMUSG00000034021
Gene NamePDS5 cohesin associated factor B
SynonymsAprin, AS3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8211 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location150673739-150810690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150728942 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 225 (T225A)
Ref Sequence ENSEMBL: ENSMUSP00000016569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016569] [ENSMUST00000038900] [ENSMUST00000202170]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016569
AA Change: T225A

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000016569
Gene: ENSMUSG00000034021
AA Change: T225A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 244 773 6e-33 SMART
low complexity region 1156 1167 N/A INTRINSIC
AT_hook 1247 1259 4.14e1 SMART
AT_hook 1285 1297 1.35e2 SMART
low complexity region 1307 1316 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
AT_hook 1370 1382 1.46e0 SMART
low complexity region 1437 1446 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000038900
AA Change: T225A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038421
Gene: ENSMUSG00000034021
AA Change: T225A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 244 773 6e-33 SMART
low complexity region 1156 1167 N/A INTRINSIC
AT_hook 1249 1261 4.14e1 SMART
AT_hook 1287 1299 1.35e2 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
AT_hook 1373 1385 1.46e0 SMART
low complexity region 1440 1449 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202170
AA Change: T225A

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144572
Gene: ENSMUSG00000034021
AA Change: T225A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 244 773 6e-33 SMART
low complexity region 1156 1167 N/A INTRINSIC
AT_hook 1249 1261 4.14e1 SMART
AT_hook 1287 1299 1.35e2 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
AT_hook 1372 1384 1.46e0 SMART
low complexity region 1439 1448 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the conserved protein complex termed cohesin. The cohesin complex holds together sister chromatids and facilitates accurate chromosome segregation during mitosis and meiosis. This protein is also a negative regulator of cell proliferation and may be a tumor-suppressor gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality with cardiac defects, craniofacial abnormalities, axial skeletal defects, shortening of most of the long bones, abnormal enteric nervous system morphology, and decreased germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,435 I28V possibly damaging Het
A330017A19Rik A G 17: 46,890,383 probably benign Het
Adamtsl3 T C 7: 82,523,163 S445P probably damaging Het
Afp T C 5: 90,501,486 I304T possibly damaging Het
Alk G A 17: 71,869,707 A1534V probably benign Het
Ank3 C T 10: 69,867,398 P287L unknown Het
Appl1 T C 14: 26,945,598 I367V probably benign Het
Arpin T A 7: 79,935,244 M1L probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
B430203G13Rik A T 12: 17,924,539 H82L noncoding transcript Het
Bcl11a T A 11: 24,078,394 S2T probably damaging Het
Cfap46 T A 7: 139,633,304 M1605L unknown Het
Chga C A 12: 102,561,419 Q111K possibly damaging Het
Drc7 A G 8: 95,056,079 E24G unknown Het
Dst T C 1: 34,212,451 L2195P probably damaging Het
Enpp5 G A 17: 44,081,511 probably null Het
Fat2 A G 11: 55,312,209 L13P possibly damaging Het
Grhl1 T C 12: 24,586,152 probably null Het
Ikbke A G 1: 131,271,778 I326T probably damaging Het
Krt26 C T 11: 99,335,284 D195N probably damaging Het
Lamc2 A T 1: 153,166,278 C37S probably damaging Het
Lrriq1 A G 10: 103,170,547 L1239P probably damaging Het
Mrps5 T A 2: 127,603,724 H390Q probably benign Het
Nphp3 T A 9: 104,031,897 C769S possibly damaging Het
Obscn A G 11: 59,115,794 S1181P probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pabpc6 G T 17: 9,669,457 A55E probably damaging Het
Pcdha9 A T 18: 36,998,859 E327V possibly damaging Het
Pi4ka A C 16: 17,282,905 I1807S Het
Pick1 T A 15: 79,248,730 I330N probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rubcn A C 16: 32,836,543 C502W possibly damaging Het
Slc26a10 G A 10: 127,173,965 R571C probably benign Het
Slc44a2 A T 9: 21,348,138 N587Y probably damaging Het
Slfn2 T G 11: 83,069,759 V188G possibly damaging Het
Smok2b T C 17: 13,235,793 V280A probably benign Het
Snx19 A G 9: 30,437,465 E798G probably benign Het
Sspo T C 6: 48,492,609 probably null Het
Ugt2b37 T C 5: 87,242,376 I404V probably benign Het
Vmn1r160 T C 7: 22,871,326 F35L possibly damaging Het
Vmn1r193 A T 13: 22,219,116 Y235* probably null Het
Vmn2r53 T C 7: 12,581,916 I659V probably benign Het
Vmn2r91 A G 17: 18,106,500 D349G probably damaging Het
Zfp292 A T 4: 34,806,163 S2299T probably benign Het
Zfp938 T C 10: 82,226,585 N67S possibly damaging Het
Other mutations in Pds5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Pds5b APN 5 150722542 missense probably benign 0.25
IGL01530:Pds5b APN 5 150792175 missense probably benign 0.38
IGL01812:Pds5b APN 5 150780689 missense probably damaging 1.00
IGL02163:Pds5b APN 5 150756406 missense probably benign 0.00
IGL02730:Pds5b APN 5 150780752 splice site probably benign
IGL02825:Pds5b APN 5 150728970 missense possibly damaging 0.90
IGL03143:Pds5b APN 5 150779257 missense probably damaging 1.00
IGL03379:Pds5b APN 5 150788331 missense probably damaging 1.00
PIT4283001:Pds5b UTSW 5 150778309 missense probably damaging 0.99
R0026:Pds5b UTSW 5 150749830 splice site probably benign
R0197:Pds5b UTSW 5 150754431 missense probably benign 0.28
R0347:Pds5b UTSW 5 150736427 splice site probably benign
R0396:Pds5b UTSW 5 150779275 missense possibly damaging 0.96
R0400:Pds5b UTSW 5 150723353 missense possibly damaging 0.46
R0442:Pds5b UTSW 5 150716544 splice site probably benign
R0745:Pds5b UTSW 5 150805671 missense probably benign
R0839:Pds5b UTSW 5 150764962 missense probably benign 0.23
R0866:Pds5b UTSW 5 150739191 splice site probably benign
R1247:Pds5b UTSW 5 150775354 critical splice acceptor site probably benign
R1330:Pds5b UTSW 5 150761077 missense probably damaging 0.97
R1440:Pds5b UTSW 5 150754417 missense probably damaging 1.00
R1526:Pds5b UTSW 5 150716400 splice site probably null
R2010:Pds5b UTSW 5 150775354 critical splice acceptor site probably benign
R2051:Pds5b UTSW 5 150748190 missense probably damaging 1.00
R2507:Pds5b UTSW 5 150756428 missense possibly damaging 0.90
R3111:Pds5b UTSW 5 150719907 missense probably damaging 1.00
R3820:Pds5b UTSW 5 150736337 missense possibly damaging 0.94
R3911:Pds5b UTSW 5 150746706 missense probably benign 0.41
R4077:Pds5b UTSW 5 150794359 missense possibly damaging 0.62
R4118:Pds5b UTSW 5 150775354 critical splice acceptor site probably benign
R4342:Pds5b UTSW 5 150800854 missense probably benign 0.17
R4416:Pds5b UTSW 5 150736396 missense probably damaging 1.00
R4503:Pds5b UTSW 5 150728934 missense probably damaging 1.00
R4524:Pds5b UTSW 5 150788316 missense probably damaging 1.00
R4579:Pds5b UTSW 5 150746732 missense probably damaging 0.98
R4623:Pds5b UTSW 5 150800601 missense probably benign 0.37
R4847:Pds5b UTSW 5 150748112 missense probably damaging 1.00
R4885:Pds5b UTSW 5 150716462 missense probably benign 0.21
R5271:Pds5b UTSW 5 150723353 missense possibly damaging 0.46
R5281:Pds5b UTSW 5 150746608 missense probably benign 0.26
R5337:Pds5b UTSW 5 150793597 missense probably benign 0.03
R5635:Pds5b UTSW 5 150778221 missense possibly damaging 0.78
R5677:Pds5b UTSW 5 150716461 missense possibly damaging 0.91
R6005:Pds5b UTSW 5 150769776 splice site probably null
R6139:Pds5b UTSW 5 150800777 missense possibly damaging 0.81
R6225:Pds5b UTSW 5 150746618 missense probably damaging 0.98
R6279:Pds5b UTSW 5 150723248 missense possibly damaging 0.80
R6300:Pds5b UTSW 5 150723248 missense possibly damaging 0.80
R6666:Pds5b UTSW 5 150778166 missense probably damaging 1.00
R6805:Pds5b UTSW 5 150805561 splice site probably null
R7038:Pds5b UTSW 5 150800760 missense probably benign 0.02
R7046:Pds5b UTSW 5 150749920 missense probably damaging 1.00
R7051:Pds5b UTSW 5 150794282 missense possibly damaging 0.78
R7138:Pds5b UTSW 5 150800677 nonsense probably null
R7255:Pds5b UTSW 5 150796667 missense probably benign 0.33
R7467:Pds5b UTSW 5 150736327 missense probably damaging 0.99
R7488:Pds5b UTSW 5 150723337 missense probably damaging 0.97
R7512:Pds5b UTSW 5 150788342 missense probably damaging 1.00
R7561:Pds5b UTSW 5 150739318 critical splice donor site probably null
R7576:Pds5b UTSW 5 150778261 missense probably damaging 1.00
R7889:Pds5b UTSW 5 150792172 missense probably damaging 1.00
R7982:Pds5b UTSW 5 150769941 missense probably damaging 1.00
R8059:Pds5b UTSW 5 150807835 missense unknown
R8412:Pds5b UTSW 5 150719959 missense probably damaging 1.00
R8503:Pds5b UTSW 5 150716507 missense possibly damaging 0.95
R8556:Pds5b UTSW 5 150792608 missense probably benign
R8786:Pds5b UTSW 5 150780669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACAGGGCTAGGGATATGTTC -3'
(R):5'- GCACAGACAAGAGTTAGCCTTC -3'

Sequencing Primer
(F):5'- TTCTGTGGTAGAGCCGAGGAAG -3'
(R):5'- AGAAACTTTAGGAGAGGAGAATGG -3'
Posted On2020-07-13