Incidental Mutation 'R8211:Vmn2r53'
ID 636163
Institutional Source Beutler Lab
Gene Symbol Vmn2r53
Ensembl Gene ENSMUSG00000096002
Gene Name vomeronasal 2, receptor 53
Synonyms EG637908
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R8211 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 12581470-12606544 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12581916 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 659 (I659V)
Ref Sequence ENSEMBL: ENSMUSP00000126979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170412]
AlphaFold A0A3B2W4A7
Predicted Effect probably benign
Transcript: ENSMUST00000170412
AA Change: I659V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000126979
Gene: ENSMUSG00000096002
AA Change: I659V

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.6e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 3.1e-53 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,435 I28V possibly damaging Het
A330017A19Rik A G 17: 46,890,383 probably benign Het
Adamtsl3 T C 7: 82,523,163 S445P probably damaging Het
Afp T C 5: 90,501,486 I304T possibly damaging Het
Alk G A 17: 71,869,707 A1534V probably benign Het
Ank3 C T 10: 69,867,398 P287L unknown Het
Appl1 T C 14: 26,945,598 I367V probably benign Het
Arpin T A 7: 79,935,244 M1L probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
B430203G13Rik A T 12: 17,924,539 H82L noncoding transcript Het
Bcl11a T A 11: 24,078,394 S2T probably damaging Het
Cfap46 T A 7: 139,633,304 M1605L unknown Het
Chga C A 12: 102,561,419 Q111K possibly damaging Het
Drc7 A G 8: 95,056,079 E24G unknown Het
Dst T C 1: 34,212,451 L2195P probably damaging Het
Enpp5 G A 17: 44,081,511 probably null Het
Fat2 A G 11: 55,312,209 L13P possibly damaging Het
Grhl1 T C 12: 24,586,152 probably null Het
Ikbke A G 1: 131,271,778 I326T probably damaging Het
Krt26 C T 11: 99,335,284 D195N probably damaging Het
Lamc2 A T 1: 153,166,278 C37S probably damaging Het
Lrriq1 A G 10: 103,170,547 L1239P probably damaging Het
Mrps5 T A 2: 127,603,724 H390Q probably benign Het
Nphp3 T A 9: 104,031,897 C769S possibly damaging Het
Obscn A G 11: 59,115,794 S1181P probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pabpc6 G T 17: 9,669,457 A55E probably damaging Het
Pcdha9 A T 18: 36,998,859 E327V possibly damaging Het
Pds5b A G 5: 150,728,942 T225A possibly damaging Het
Pi4ka A C 16: 17,282,905 I1807S Het
Pick1 T A 15: 79,248,730 I330N probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rubcn A C 16: 32,836,543 C502W possibly damaging Het
Slc26a10 G A 10: 127,173,965 R571C probably benign Het
Slc44a2 A T 9: 21,348,138 N587Y probably damaging Het
Slfn2 T G 11: 83,069,759 V188G possibly damaging Het
Smok2b T C 17: 13,235,793 V280A probably benign Het
Snx19 A G 9: 30,437,465 E798G probably benign Het
Sspo T C 6: 48,492,609 probably null Het
Ugt2b37 T C 5: 87,242,376 I404V probably benign Het
Vmn1r160 T C 7: 22,871,326 F35L possibly damaging Het
Vmn1r193 A T 13: 22,219,116 Y235* probably null Het
Vmn2r91 A G 17: 18,106,500 D349G probably damaging Het
Zfp292 A T 4: 34,806,163 S2299T probably benign Het
Zfp938 T C 10: 82,226,585 N67S possibly damaging Het
Other mutations in Vmn2r53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r53 APN 7 12600908 missense possibly damaging 0.70
IGL01997:Vmn2r53 APN 7 12582446 missense possibly damaging 0.54
IGL02442:Vmn2r53 APN 7 12581729 missense probably damaging 1.00
IGL02449:Vmn2r53 APN 7 12582361 missense probably damaging 1.00
IGL02589:Vmn2r53 APN 7 12581945 missense possibly damaging 0.93
IGL02986:Vmn2r53 APN 7 12581466 unclassified probably benign
IGL03064:Vmn2r53 APN 7 12601010 missense possibly damaging 0.89
IGL03093:Vmn2r53 APN 7 12600864 missense probably benign 0.03
IGL03244:Vmn2r53 APN 7 12606508 missense probably damaging 1.00
IGL03252:Vmn2r53 APN 7 12606391 missense probably damaging 1.00
IGL03264:Vmn2r53 APN 7 12581892 missense possibly damaging 0.95
IGL03293:Vmn2r53 APN 7 12598422 missense probably benign 0.34
R0109:Vmn2r53 UTSW 7 12582066 missense probably damaging 1.00
R0453:Vmn2r53 UTSW 7 12582411 missense probably damaging 1.00
R0735:Vmn2r53 UTSW 7 12581780 missense probably benign
R0881:Vmn2r53 UTSW 7 12600932 missense probably benign 0.01
R0894:Vmn2r53 UTSW 7 12601214 missense probably benign 0.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0974:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0990:Vmn2r53 UTSW 7 12581502 missense probably benign
R1102:Vmn2r53 UTSW 7 12598483 missense possibly damaging 0.94
R1141:Vmn2r53 UTSW 7 12600746 missense possibly damaging 0.54
R1263:Vmn2r53 UTSW 7 12581606 missense probably benign 0.41
R1343:Vmn2r53 UTSW 7 12584774 missense probably benign 0.08
R1750:Vmn2r53 UTSW 7 12581705 missense probably damaging 1.00
R1836:Vmn2r53 UTSW 7 12600885 missense probably damaging 1.00
R2035:Vmn2r53 UTSW 7 12598511 missense possibly damaging 0.76
R2202:Vmn2r53 UTSW 7 12601439 missense probably damaging 1.00
R3707:Vmn2r53 UTSW 7 12582054 missense possibly damaging 0.95
R4372:Vmn2r53 UTSW 7 12581729 missense probably damaging 0.98
R4615:Vmn2r53 UTSW 7 12582302 missense probably damaging 1.00
R4655:Vmn2r53 UTSW 7 12582005 missense possibly damaging 0.83
R4663:Vmn2r53 UTSW 7 12600974 missense probably benign 0.21
R4708:Vmn2r53 UTSW 7 12601202 missense probably benign
R4710:Vmn2r53 UTSW 7 12601202 missense probably benign
R4774:Vmn2r53 UTSW 7 12600765 nonsense probably null
R4859:Vmn2r53 UTSW 7 12601403 missense probably damaging 1.00
R5061:Vmn2r53 UTSW 7 12581814 missense probably benign 0.01
R5561:Vmn2r53 UTSW 7 12601420 missense probably damaging 1.00
R5729:Vmn2r53 UTSW 7 12600806 missense probably damaging 1.00
R6004:Vmn2r53 UTSW 7 12582401 missense probably benign 0.12
R6083:Vmn2r53 UTSW 7 12581881 missense probably benign
R6312:Vmn2r53 UTSW 7 12598639 critical splice acceptor site probably null
R6700:Vmn2r53 UTSW 7 12581706 missense probably damaging 0.96
R6783:Vmn2r53 UTSW 7 12601433 missense probably damaging 1.00
R6852:Vmn2r53 UTSW 7 12606514 missense probably damaging 0.99
R6889:Vmn2r53 UTSW 7 12601142 missense probably benign 0.10
R6940:Vmn2r53 UTSW 7 12582416 missense probably benign 0.19
R7100:Vmn2r53 UTSW 7 12581586 nonsense probably null
R7174:Vmn2r53 UTSW 7 12581701 missense probably benign 0.01
R7213:Vmn2r53 UTSW 7 12601056 missense probably benign 0.17
R7276:Vmn2r53 UTSW 7 12606432 missense probably damaging 0.99
R7515:Vmn2r53 UTSW 7 12581919 missense probably benign 0.05
R7678:Vmn2r53 UTSW 7 12598498 missense probably benign 0.04
R7714:Vmn2r53 UTSW 7 12606491 missense probably damaging 1.00
R7843:Vmn2r53 UTSW 7 12582099 missense probably damaging 1.00
R8208:Vmn2r53 UTSW 7 12601395 missense probably damaging 1.00
R8478:Vmn2r53 UTSW 7 12606354 missense probably benign 0.01
R8853:Vmn2r53 UTSW 7 12581810 missense probably damaging 1.00
R8924:Vmn2r53 UTSW 7 12600825 missense probably benign 0.17
R8963:Vmn2r53 UTSW 7 12581999 missense probably damaging 1.00
R9042:Vmn2r53 UTSW 7 12581508 missense probably benign
R9076:Vmn2r53 UTSW 7 12606304 missense probably damaging 1.00
R9407:Vmn2r53 UTSW 7 12601197 missense probably damaging 0.99
Z1176:Vmn2r53 UTSW 7 12601304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCCAGACACTGCAGAAG -3'
(R):5'- GGTATTCACAGTGGCTGTCTC -3'

Sequencing Primer
(F):5'- TGCAGAAGAGCAGCATGC -3'
(R):5'- CGTTCTGGCTAAGACTCTAACAGTG -3'
Posted On 2020-07-13