Incidental Mutation 'R8211:Vmn2r53'
ID636163
Institutional Source Beutler Lab
Gene Symbol Vmn2r53
Ensembl Gene ENSMUSG00000096002
Gene Namevomeronasal 2, receptor 53
SynonymsEG637908
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R8211 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location12581470-12606544 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12581916 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 659 (I659V)
Ref Sequence ENSEMBL: ENSMUSP00000126979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170412]
Predicted Effect probably benign
Transcript: ENSMUST00000170412
AA Change: I659V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000126979
Gene: ENSMUSG00000096002
AA Change: I659V

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.6e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 3.1e-53 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,435 I28V possibly damaging Het
A330017A19Rik A G 17: 46,890,383 probably benign Het
Adamtsl3 T C 7: 82,523,163 S445P probably damaging Het
Afp T C 5: 90,501,486 I304T possibly damaging Het
Alk G A 17: 71,869,707 A1534V probably benign Het
Ank3 C T 10: 69,867,398 P287L unknown Het
Appl1 T C 14: 26,945,598 I367V probably benign Het
Arpin T A 7: 79,935,244 M1L probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
B430203G13Rik A T 12: 17,924,539 H82L noncoding transcript Het
Bcl11a T A 11: 24,078,394 S2T probably damaging Het
Cfap46 T A 7: 139,633,304 M1605L unknown Het
Chga C A 12: 102,561,419 Q111K possibly damaging Het
Drc7 A G 8: 95,056,079 E24G unknown Het
Dst T C 1: 34,212,451 L2195P probably damaging Het
Enpp5 G A 17: 44,081,511 probably null Het
Fat2 A G 11: 55,312,209 L13P possibly damaging Het
Grhl1 T C 12: 24,586,152 probably null Het
Ikbke A G 1: 131,271,778 I326T probably damaging Het
Krt26 C T 11: 99,335,284 D195N probably damaging Het
Lamc2 A T 1: 153,166,278 C37S probably damaging Het
Lrriq1 A G 10: 103,170,547 L1239P probably damaging Het
Mrps5 T A 2: 127,603,724 H390Q probably benign Het
Nphp3 T A 9: 104,031,897 C769S possibly damaging Het
Obscn A G 11: 59,115,794 S1181P probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pabpc6 G T 17: 9,669,457 A55E probably damaging Het
Pcdha9 A T 18: 36,998,859 E327V possibly damaging Het
Pds5b A G 5: 150,728,942 T225A possibly damaging Het
Pi4ka A C 16: 17,282,905 I1807S Het
Pick1 T A 15: 79,248,730 I330N probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rubcn A C 16: 32,836,543 C502W possibly damaging Het
Slc26a10 G A 10: 127,173,965 R571C probably benign Het
Slc44a2 A T 9: 21,348,138 N587Y probably damaging Het
Slfn2 T G 11: 83,069,759 V188G possibly damaging Het
Smok2b T C 17: 13,235,793 V280A probably benign Het
Snx19 A G 9: 30,437,465 E798G probably benign Het
Sspo T C 6: 48,492,609 probably null Het
Ugt2b37 T C 5: 87,242,376 I404V probably benign Het
Vmn1r160 T C 7: 22,871,326 F35L possibly damaging Het
Vmn1r193 A T 13: 22,219,116 Y235* probably null Het
Vmn2r91 A G 17: 18,106,500 D349G probably damaging Het
Zfp292 A T 4: 34,806,163 S2299T probably benign Het
Zfp938 T C 10: 82,226,585 N67S possibly damaging Het
Other mutations in Vmn2r53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r53 APN 7 12600908 missense possibly damaging 0.70
IGL01997:Vmn2r53 APN 7 12582446 missense possibly damaging 0.54
IGL02442:Vmn2r53 APN 7 12581729 missense probably damaging 1.00
IGL02449:Vmn2r53 APN 7 12582361 missense probably damaging 1.00
IGL02589:Vmn2r53 APN 7 12581945 missense possibly damaging 0.93
IGL02986:Vmn2r53 APN 7 12581466 unclassified probably benign
IGL03064:Vmn2r53 APN 7 12601010 missense possibly damaging 0.89
IGL03093:Vmn2r53 APN 7 12600864 missense probably benign 0.03
IGL03244:Vmn2r53 APN 7 12606508 missense probably damaging 1.00
IGL03252:Vmn2r53 APN 7 12606391 missense probably damaging 1.00
IGL03264:Vmn2r53 APN 7 12581892 missense possibly damaging 0.95
IGL03293:Vmn2r53 APN 7 12598422 missense probably benign 0.34
R0109:Vmn2r53 UTSW 7 12582066 missense probably damaging 1.00
R0453:Vmn2r53 UTSW 7 12582411 missense probably damaging 1.00
R0735:Vmn2r53 UTSW 7 12581780 missense probably benign
R0881:Vmn2r53 UTSW 7 12600932 missense probably benign 0.01
R0894:Vmn2r53 UTSW 7 12601214 missense probably benign 0.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0974:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0990:Vmn2r53 UTSW 7 12581502 missense probably benign
R1102:Vmn2r53 UTSW 7 12598483 missense possibly damaging 0.94
R1141:Vmn2r53 UTSW 7 12600746 missense possibly damaging 0.54
R1263:Vmn2r53 UTSW 7 12581606 missense probably benign 0.41
R1343:Vmn2r53 UTSW 7 12584774 missense probably benign 0.08
R1750:Vmn2r53 UTSW 7 12581705 missense probably damaging 1.00
R1836:Vmn2r53 UTSW 7 12600885 missense probably damaging 1.00
R2035:Vmn2r53 UTSW 7 12598511 missense possibly damaging 0.76
R2202:Vmn2r53 UTSW 7 12601439 missense probably damaging 1.00
R3707:Vmn2r53 UTSW 7 12582054 missense possibly damaging 0.95
R4372:Vmn2r53 UTSW 7 12581729 missense probably damaging 0.98
R4615:Vmn2r53 UTSW 7 12582302 missense probably damaging 1.00
R4655:Vmn2r53 UTSW 7 12582005 missense possibly damaging 0.83
R4663:Vmn2r53 UTSW 7 12600974 missense probably benign 0.21
R4708:Vmn2r53 UTSW 7 12601202 missense probably benign
R4710:Vmn2r53 UTSW 7 12601202 missense probably benign
R4774:Vmn2r53 UTSW 7 12600765 nonsense probably null
R4859:Vmn2r53 UTSW 7 12601403 missense probably damaging 1.00
R5061:Vmn2r53 UTSW 7 12581814 missense probably benign 0.01
R5561:Vmn2r53 UTSW 7 12601420 missense probably damaging 1.00
R5729:Vmn2r53 UTSW 7 12600806 missense probably damaging 1.00
R6004:Vmn2r53 UTSW 7 12582401 missense probably benign 0.12
R6083:Vmn2r53 UTSW 7 12581881 missense probably benign
R6312:Vmn2r53 UTSW 7 12598639 critical splice acceptor site probably null
R6700:Vmn2r53 UTSW 7 12581706 missense probably damaging 0.96
R6783:Vmn2r53 UTSW 7 12601433 missense probably damaging 1.00
R6852:Vmn2r53 UTSW 7 12606514 missense probably damaging 0.99
R6889:Vmn2r53 UTSW 7 12601142 missense probably benign 0.10
R6940:Vmn2r53 UTSW 7 12582416 missense probably benign 0.19
R7100:Vmn2r53 UTSW 7 12581586 nonsense probably null
R7174:Vmn2r53 UTSW 7 12581701 missense probably benign 0.01
R7213:Vmn2r53 UTSW 7 12601056 missense probably benign 0.17
R7276:Vmn2r53 UTSW 7 12606432 missense probably damaging 0.99
R7515:Vmn2r53 UTSW 7 12581919 missense probably benign 0.05
R7678:Vmn2r53 UTSW 7 12598498 missense probably benign 0.04
R7714:Vmn2r53 UTSW 7 12606491 missense probably damaging 1.00
R7843:Vmn2r53 UTSW 7 12582099 missense probably damaging 1.00
R8208:Vmn2r53 UTSW 7 12601395 missense probably damaging 1.00
R8478:Vmn2r53 UTSW 7 12606354 missense probably benign 0.01
R8853:Vmn2r53 UTSW 7 12581810 missense probably damaging 1.00
Z1176:Vmn2r53 UTSW 7 12601304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCCAGACACTGCAGAAG -3'
(R):5'- GGTATTCACAGTGGCTGTCTC -3'

Sequencing Primer
(F):5'- TGCAGAAGAGCAGCATGC -3'
(R):5'- CGTTCTGGCTAAGACTCTAACAGTG -3'
Posted On2020-07-13