Incidental Mutation 'R8211:Arpin'
ID636165
Institutional Source Beutler Lab
Gene Symbol Arpin
Ensembl Gene ENSMUSG00000039043
Gene Nameactin-related protein 2/3 complex inhibitor
Synonyms2610034B18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8211 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location79925361-79935359 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 79935244 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000049440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048731]
Predicted Effect probably damaging
Transcript: ENSMUST00000048731
AA Change: M1L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049440
Gene: ENSMUSG00000039043
AA Change: M1L

DomainStartEndE-ValueType
Pfam:UPF0552 1 224 4e-110 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,435 I28V possibly damaging Het
A330017A19Rik A G 17: 46,890,383 probably benign Het
Adamtsl3 T C 7: 82,523,163 S445P probably damaging Het
Afp T C 5: 90,501,486 I304T possibly damaging Het
Alk G A 17: 71,869,707 A1534V probably benign Het
Ank3 C T 10: 69,867,398 P287L unknown Het
Appl1 T C 14: 26,945,598 I367V probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
B430203G13Rik A T 12: 17,924,539 H82L noncoding transcript Het
Bcl11a T A 11: 24,078,394 S2T probably damaging Het
Cfap46 T A 7: 139,633,304 M1605L unknown Het
Chga C A 12: 102,561,419 Q111K possibly damaging Het
Drc7 A G 8: 95,056,079 E24G unknown Het
Dst T C 1: 34,212,451 L2195P probably damaging Het
Enpp5 G A 17: 44,081,511 probably null Het
Fat2 A G 11: 55,312,209 L13P possibly damaging Het
Grhl1 T C 12: 24,586,152 probably null Het
Ikbke A G 1: 131,271,778 I326T probably damaging Het
Krt26 C T 11: 99,335,284 D195N probably damaging Het
Lamc2 A T 1: 153,166,278 C37S probably damaging Het
Lrriq1 A G 10: 103,170,547 L1239P probably damaging Het
Mrps5 T A 2: 127,603,724 H390Q probably benign Het
Nphp3 T A 9: 104,031,897 C769S possibly damaging Het
Obscn A G 11: 59,115,794 S1181P probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pabpc6 G T 17: 9,669,457 A55E probably damaging Het
Pcdha9 A T 18: 36,998,859 E327V possibly damaging Het
Pds5b A G 5: 150,728,942 T225A possibly damaging Het
Pi4ka A C 16: 17,282,905 I1807S Het
Pick1 T A 15: 79,248,730 I330N probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rubcn A C 16: 32,836,543 C502W possibly damaging Het
Slc26a10 G A 10: 127,173,965 R571C probably benign Het
Slc44a2 A T 9: 21,348,138 N587Y probably damaging Het
Slfn2 T G 11: 83,069,759 V188G possibly damaging Het
Smok2b T C 17: 13,235,793 V280A probably benign Het
Snx19 A G 9: 30,437,465 E798G probably benign Het
Sspo T C 6: 48,492,609 probably null Het
Ugt2b37 T C 5: 87,242,376 I404V probably benign Het
Vmn1r160 T C 7: 22,871,326 F35L possibly damaging Het
Vmn1r193 A T 13: 22,219,116 Y235* probably null Het
Vmn2r53 T C 7: 12,581,916 I659V probably benign Het
Vmn2r91 A G 17: 18,106,500 D349G probably damaging Het
Zfp292 A T 4: 34,806,163 S2299T probably benign Het
Zfp938 T C 10: 82,226,585 N67S possibly damaging Het
Other mutations in Arpin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Arpin APN 7 79927675 missense probably benign 0.00
IGL01393:Arpin APN 7 79931840 missense possibly damaging 0.51
IGL02127:Arpin APN 7 79928193 missense probably benign 0.01
IGL02553:Arpin APN 7 79927647 missense possibly damaging 0.71
R2350:Arpin UTSW 7 79931805 nonsense probably null
R3821:Arpin UTSW 7 79929660 missense probably damaging 1.00
R3924:Arpin UTSW 7 79929687 missense probably benign 0.02
R5287:Arpin UTSW 7 79928249 missense probably damaging 1.00
R6353:Arpin UTSW 7 79935345 start gained probably benign
R7871:Arpin UTSW 7 79927715 missense probably damaging 1.00
R8350:Arpin UTSW 7 79931867 missense possibly damaging 0.96
R8367:Arpin UTSW 7 79929638 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTGGACAGAGTACAACCCAC -3'
(R):5'- AAGGACAGTGGTCATTCCAAAAGC -3'

Sequencing Primer
(F):5'- GAGTACAACCCACCCCTGGTC -3'
(R):5'- CCTGTTACTGCACGAGGTCTG -3'
Posted On2020-07-13