Incidental Mutation 'R8211:Drc7'
ID636168
Institutional Source Beutler Lab
Gene Symbol Drc7
Ensembl Gene ENSMUSG00000031786
Gene Namedynein regulatory complex subunit 7
SynonymsSRG-L, LOC330830, Ccdc135
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8211 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location95055103-95078141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95056079 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 24 (E24G)
Ref Sequence ENSEMBL: ENSMUSP00000053972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058479]
Predicted Effect unknown
Transcript: ENSMUST00000058479
AA Change: E24G
SMART Domains Protein: ENSMUSP00000053972
Gene: ENSMUSG00000031786
AA Change: E24G

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
coiled coil region 258 295 N/A INTRINSIC
low complexity region 388 411 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 695 710 N/A INTRINSIC
low complexity region 798 809 N/A INTRINSIC
low complexity region 848 864 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,435 I28V possibly damaging Het
A330017A19Rik A G 17: 46,890,383 probably benign Het
Adamtsl3 T C 7: 82,523,163 S445P probably damaging Het
Afp T C 5: 90,501,486 I304T possibly damaging Het
Alk G A 17: 71,869,707 A1534V probably benign Het
Ank3 C T 10: 69,867,398 P287L unknown Het
Appl1 T C 14: 26,945,598 I367V probably benign Het
Arpin T A 7: 79,935,244 M1L probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
B430203G13Rik A T 12: 17,924,539 H82L noncoding transcript Het
Bcl11a T A 11: 24,078,394 S2T probably damaging Het
Cfap46 T A 7: 139,633,304 M1605L unknown Het
Chga C A 12: 102,561,419 Q111K possibly damaging Het
Dst T C 1: 34,212,451 L2195P probably damaging Het
Enpp5 G A 17: 44,081,511 probably null Het
Fat2 A G 11: 55,312,209 L13P possibly damaging Het
Grhl1 T C 12: 24,586,152 probably null Het
Ikbke A G 1: 131,271,778 I326T probably damaging Het
Krt26 C T 11: 99,335,284 D195N probably damaging Het
Lamc2 A T 1: 153,166,278 C37S probably damaging Het
Lrriq1 A G 10: 103,170,547 L1239P probably damaging Het
Mrps5 T A 2: 127,603,724 H390Q probably benign Het
Nphp3 T A 9: 104,031,897 C769S possibly damaging Het
Obscn A G 11: 59,115,794 S1181P probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pabpc6 G T 17: 9,669,457 A55E probably damaging Het
Pcdha9 A T 18: 36,998,859 E327V possibly damaging Het
Pds5b A G 5: 150,728,942 T225A possibly damaging Het
Pi4ka A C 16: 17,282,905 I1807S Het
Pick1 T A 15: 79,248,730 I330N probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rubcn A C 16: 32,836,543 C502W possibly damaging Het
Slc26a10 G A 10: 127,173,965 R571C probably benign Het
Slc44a2 A T 9: 21,348,138 N587Y probably damaging Het
Slfn2 T G 11: 83,069,759 V188G possibly damaging Het
Smok2b T C 17: 13,235,793 V280A probably benign Het
Snx19 A G 9: 30,437,465 E798G probably benign Het
Sspo T C 6: 48,492,609 probably null Het
Ugt2b37 T C 5: 87,242,376 I404V probably benign Het
Vmn1r160 T C 7: 22,871,326 F35L possibly damaging Het
Vmn1r193 A T 13: 22,219,116 Y235* probably null Het
Vmn2r53 T C 7: 12,581,916 I659V probably benign Het
Vmn2r91 A G 17: 18,106,500 D349G probably damaging Het
Zfp292 A T 4: 34,806,163 S2299T probably benign Het
Zfp938 T C 10: 82,226,585 N67S possibly damaging Het
Other mutations in Drc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Drc7 APN 8 95056001 splice site probably benign
IGL00922:Drc7 APN 8 95077978 missense probably benign 0.00
IGL01610:Drc7 APN 8 95077802 missense probably damaging 1.00
IGL01642:Drc7 APN 8 95059139 missense probably benign 0.34
IGL01793:Drc7 APN 8 95071277 missense probably benign 0.25
IGL01936:Drc7 APN 8 95074132 missense possibly damaging 0.89
IGL01953:Drc7 APN 8 95059125 missense probably damaging 1.00
IGL01998:Drc7 APN 8 95059193 missense probably damaging 1.00
IGL02237:Drc7 APN 8 95072879 missense probably damaging 1.00
IGL02259:Drc7 APN 8 95056105 missense probably benign
IGL02285:Drc7 APN 8 95071233 splice site probably benign
IGL02940:Drc7 APN 8 95074297 missense probably damaging 0.99
IGL03032:Drc7 APN 8 95076247 splice site probably benign
IGL03181:Drc7 APN 8 95068127 missense probably benign 0.00
R0018:Drc7 UTSW 8 95074234 missense probably damaging 0.99
R0018:Drc7 UTSW 8 95074234 missense probably damaging 0.99
R0281:Drc7 UTSW 8 95071253 missense possibly damaging 0.61
R0304:Drc7 UTSW 8 95059128 missense probably damaging 1.00
R0362:Drc7 UTSW 8 95072855 missense probably benign 0.00
R1127:Drc7 UTSW 8 95072788 missense probably damaging 0.98
R1635:Drc7 UTSW 8 95074332 critical splice donor site probably null
R1921:Drc7 UTSW 8 95056016 missense unknown
R1931:Drc7 UTSW 8 95071253 missense possibly damaging 0.61
R2256:Drc7 UTSW 8 95075009 missense probably benign 0.16
R3851:Drc7 UTSW 8 95061836 nonsense probably null
R4797:Drc7 UTSW 8 95074297 missense probably damaging 0.96
R4827:Drc7 UTSW 8 95071639 missense probably damaging 0.98
R4966:Drc7 UTSW 8 95071596 missense probably benign 0.45
R5194:Drc7 UTSW 8 95061717 missense probably benign 0.00
R5721:Drc7 UTSW 8 95074333 critical splice donor site probably null
R5911:Drc7 UTSW 8 95074126 missense probably damaging 1.00
R5993:Drc7 UTSW 8 95074192 missense probably benign
R6056:Drc7 UTSW 8 95075051 missense probably damaging 1.00
R6534:Drc7 UTSW 8 95071282 missense probably damaging 1.00
R6576:Drc7 UTSW 8 95075258 missense probably damaging 0.98
R6861:Drc7 UTSW 8 95062397 critical splice donor site probably null
R7104:Drc7 UTSW 8 95059083 missense probably damaging 0.99
R7157:Drc7 UTSW 8 95074150 missense probably damaging 0.99
R7205:Drc7 UTSW 8 95077921 missense probably damaging 1.00
R7283:Drc7 UTSW 8 95071579 missense probably damaging 0.99
R7351:Drc7 UTSW 8 95058507 missense probably benign 0.25
R7567:Drc7 UTSW 8 95068056 missense probably benign 0.00
R8281:Drc7 UTSW 8 95062177 missense possibly damaging 0.81
R8401:Drc7 UTSW 8 95074135 missense probably benign
R8821:Drc7 UTSW 8 95062217 missense probably damaging 1.00
R8831:Drc7 UTSW 8 95062217 missense probably damaging 1.00
Y5404:Drc7 UTSW 8 95068150 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AAGGGATGTTGCTCCTCCTC -3'
(R):5'- ATGCTACCAATCCTGCCTTG -3'

Sequencing Primer
(F):5'- CTCCATGAGGAATGTACCTGG -3'
(R):5'- GGTCCTTTCTGACCGCCAG -3'
Posted On2020-07-13