Incidental Mutation 'R8211:Olfr921'
ID636171
Institutional Source Beutler Lab
Gene Symbol Olfr921
Ensembl Gene ENSMUSG00000049926
Gene Nameolfactory receptor 921
SynonymsMOR165-8, GA_x6K02T2PVTD-32478047-32478988
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R8211 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38773068-38779021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38775281 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 9 (V9M)
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000062124
AA Change: V9M
SMART Domains Protein: ENSMUSP00000051879
Gene: ENSMUSG00000049926
AA Change: V9M

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-48 PFAM
Pfam:7tm_1 41 290 6.3e-23 PFAM
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,435 I28V possibly damaging Het
A330017A19Rik A G 17: 46,890,383 probably benign Het
Adamtsl3 T C 7: 82,523,163 S445P probably damaging Het
Afp T C 5: 90,501,486 I304T possibly damaging Het
Alk G A 17: 71,869,707 A1534V probably benign Het
Ank3 C T 10: 69,867,398 P287L unknown Het
Appl1 T C 14: 26,945,598 I367V probably benign Het
Arpin T A 7: 79,935,244 M1L probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
B430203G13Rik A T 12: 17,924,539 H82L noncoding transcript Het
Bcl11a T A 11: 24,078,394 S2T probably damaging Het
Cfap46 T A 7: 139,633,304 M1605L unknown Het
Chga C A 12: 102,561,419 Q111K possibly damaging Het
Drc7 A G 8: 95,056,079 E24G unknown Het
Dst T C 1: 34,212,451 L2195P probably damaging Het
Enpp5 G A 17: 44,081,511 probably null Het
Fat2 A G 11: 55,312,209 L13P possibly damaging Het
Grhl1 T C 12: 24,586,152 probably null Het
Ikbke A G 1: 131,271,778 I326T probably damaging Het
Krt26 C T 11: 99,335,284 D195N probably damaging Het
Lamc2 A T 1: 153,166,278 C37S probably damaging Het
Lrriq1 A G 10: 103,170,547 L1239P probably damaging Het
Mrps5 T A 2: 127,603,724 H390Q probably benign Het
Nphp3 T A 9: 104,031,897 C769S possibly damaging Het
Obscn A G 11: 59,115,794 S1181P probably damaging Het
Pabpc6 G T 17: 9,669,457 A55E probably damaging Het
Pcdha9 A T 18: 36,998,859 E327V possibly damaging Het
Pds5b A G 5: 150,728,942 T225A possibly damaging Het
Pi4ka A C 16: 17,282,905 I1807S Het
Pick1 T A 15: 79,248,730 I330N probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rubcn A C 16: 32,836,543 C502W possibly damaging Het
Slc26a10 G A 10: 127,173,965 R571C probably benign Het
Slc44a2 A T 9: 21,348,138 N587Y probably damaging Het
Slfn2 T G 11: 83,069,759 V188G possibly damaging Het
Smok2b T C 17: 13,235,793 V280A probably benign Het
Snx19 A G 9: 30,437,465 E798G probably benign Het
Sspo T C 6: 48,492,609 probably null Het
Ugt2b37 T C 5: 87,242,376 I404V probably benign Het
Vmn1r160 T C 7: 22,871,326 F35L possibly damaging Het
Vmn1r193 A T 13: 22,219,116 Y235* probably null Het
Vmn2r53 T C 7: 12,581,916 I659V probably benign Het
Vmn2r91 A G 17: 18,106,500 D349G probably damaging Het
Zfp292 A T 4: 34,806,163 S2299T probably benign Het
Zfp938 T C 10: 82,226,585 N67S possibly damaging Het
Other mutations in Olfr921
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Olfr921 APN 9 38775812 nonsense probably null
IGL01016:Olfr921 APN 9 38775441 missense probably damaging 0.99
IGL01391:Olfr921 APN 9 38775530 missense probably damaging 1.00
IGL01451:Olfr921 APN 9 38775929 missense probably benign 0.04
IGL02250:Olfr921 APN 9 38775554 missense probably damaging 1.00
R0026:Olfr921 UTSW 9 38775596 missense probably benign 0.01
R0334:Olfr921 UTSW 9 38775239 critical splice acceptor site probably null
R0655:Olfr921 UTSW 9 38775554 nonsense probably null
R1024:Olfr921 UTSW 9 38775335 missense probably damaging 0.97
R3522:Olfr921 UTSW 9 38775720 missense possibly damaging 0.67
R3967:Olfr921 UTSW 9 38775368 missense probably benign 0.09
R3968:Olfr921 UTSW 9 38775368 missense probably benign 0.09
R3969:Olfr921 UTSW 9 38775368 missense probably benign 0.09
R4761:Olfr921 UTSW 9 38775837 missense probably benign 0.05
R4796:Olfr921 UTSW 9 38775374 missense probably benign 0.15
R4880:Olfr921 UTSW 9 38775547 nonsense probably null
R5237:Olfr921 UTSW 9 38775956 missense probably damaging 1.00
R5756:Olfr921 UTSW 9 38775258 start codon destroyed probably null 1.00
R6230:Olfr921 UTSW 9 38775777 missense possibly damaging 0.94
R6487:Olfr921 UTSW 9 38775435 missense probably damaging 1.00
R7514:Olfr921 UTSW 9 38775678 missense probably damaging 1.00
R7573:Olfr921 UTSW 9 38775495 missense probably damaging 1.00
R7755:Olfr921 UTSW 9 38775777 missense possibly damaging 0.94
R8195:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8196:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8197:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8199:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8212:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8236:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8239:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8279:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8282:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8283:Olfr921 UTSW 9 38775281 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- ACAAGCTATTCGGAAATTTCATCC -3'
(R):5'- CATAGGCCATTGACACCAGTAC -3'

Sequencing Primer
(F):5'- GCTATTCGGAAATTTCATCCTGAGC -3'
(R):5'- AAGTAGAGTTGGGACATACATCC -3'
Posted On2020-07-13