Mutagenetix > Incidental Mutation

Incidental Mutation 'R8211:Nphp3'

636172

Institutional Source

Beutler Lab

Gene Symbol

Nphp3

Ensembl Gene

ENSMUSG00000032558

Gene Name

nephronophthisis 3 (adolescent)

Synonyms

3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8211 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104002544-104043818 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 104031897 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 769 (C769S)

Ref Sequence

ENSEMBL: ENSMUSP00000035167 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194183] [ENSMUST00000194774]

AlphaFold

Q7TNH6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035167
AA Change: C769S

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: C769S

Domain	Start	End	E-Value	Type
low complexity region	46	69	N/A	INTRINSIC
coiled coil region	107	203	N/A	INTRINSIC
low complexity region	512	537	N/A	INTRINSIC
low complexity region	613	627	N/A	INTRINSIC
low complexity region	640	650	N/A	INTRINSIC
TPR	938	971	3.16e1	SMART
TPR	980	1013	7.74e-2	SMART
TPR	1022	1055	3.24e1	SMART
low complexity region	1066	1080	N/A	INTRINSIC
TPR	1088	1121	3.67e-3	SMART
TPR	1130	1163	1.3e-3	SMART
TPR	1172	1205	4.38e-1	SMART
TPR	1214	1247	8.69e-5	SMART
TPR	1256	1289	9.03e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129819
AA Change: C649S

SMART Domains

Protein: ENSMUSP00000116459
Gene: ENSMUSG00000032558
AA Change: C649S

Domain	Start	End	E-Value	Type
coiled coil region	75	109	N/A	INTRINSIC
low complexity region	418	443	N/A	INTRINSIC
low complexity region	519	532	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193439

SMART Domains

Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558

Domain	Start	End	E-Value	Type
coiled coil region	75	109	N/A	INTRINSIC
low complexity region	418	443	N/A	INTRINSIC
low complexity region	519	532	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194183

SMART Domains

Protein: ENSMUSP00000142049
Gene: ENSMUSG00000032558

Domain	Start	End	E-Value	Type
Pfam:TPR_10	1	37	3.4e-5	PFAM
Pfam:TPR_12	1	71	1.8e-14	PFAM
Pfam:TPR_10	38	79	6.5e-8	PFAM
Pfam:TPR_1	39	72	6.8e-4	PFAM
Pfam:TPR_10	81	115	9e-3	PFAM
Pfam:TPR_7	83	118	1.6e-2	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000194774
AA Change: C649S

SMART Domains

Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558
AA Change: C649S

Domain	Start	End	E-Value	Type
coiled coil region	49	83	N/A	INTRINSIC
Pfam:NACHT	400	559	2e-6	PFAM
TPR	818	851	3.16e1	SMART
TPR	860	893	7.74e-2	SMART
TPR	902	935	3.24e1	SMART
low complexity region	946	960	N/A	INTRINSIC
TPR	968	1001	3.67e-3	SMART
TPR	1010	1043	1.3e-3	SMART
TPR	1052	1085	4.38e-1	SMART
TPR	1094	1127	8.69e-5	SMART
TPR	1136	1169	9.03e-3	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	G	5: 98,329,435	I28V	possibly damaging	Het
A330017A19Rik	A	G	17: 46,890,383		probably benign	Het
Adamtsl3	T	C	7: 82,523,163	S445P	probably damaging	Het
Afp	T	C	5: 90,501,486	I304T	possibly damaging	Het
Alk	G	A	17: 71,869,707	A1534V	probably benign	Het
Ank3	C	T	10: 69,867,398	P287L	unknown	Het
Appl1	T	C	14: 26,945,598	I367V	probably benign	Het
Arpin	T	A	7: 79,935,244	M1L	probably damaging	Het
Aven	C	T	2: 112,559,775	R8W	probably benign	Het
B430203G13Rik	A	T	12: 17,924,539	H82L	noncoding transcript	Het
Bcl11a	T	A	11: 24,078,394	S2T	probably damaging	Het
Cfap46	T	A	7: 139,633,304	M1605L	unknown	Het
Chga	C	A	12: 102,561,419	Q111K	possibly damaging	Het
Drc7	A	G	8: 95,056,079	E24G	unknown	Het
Dst	T	C	1: 34,212,451	L2195P	probably damaging	Het
Enpp5	G	A	17: 44,081,511		probably null	Het
Fat2	A	G	11: 55,312,209	L13P	possibly damaging	Het
Grhl1	T	C	12: 24,586,152		probably null	Het
Ikbke	A	G	1: 131,271,778	I326T	probably damaging	Het
Krt26	C	T	11: 99,335,284	D195N	probably damaging	Het
Lamc2	A	T	1: 153,166,278	C37S	probably damaging	Het
Lrriq1	A	G	10: 103,170,547	L1239P	probably damaging	Het
Mrps5	T	A	2: 127,603,724	H390Q	probably benign	Het
Obscn	A	G	11: 59,115,794	S1181P	probably damaging	Het
Olfr921	G	A	9: 38,775,281	V9M	noncoding transcript	Het
Pabpc6	G	T	17: 9,669,457	A55E	probably damaging	Het
Pcdha9	A	T	18: 36,998,859	E327V	possibly damaging	Het
Pds5b	A	G	5: 150,728,942	T225A	possibly damaging	Het
Pi4ka	A	C	16: 17,282,905	I1807S		Het
Pick1	T	A	15: 79,248,730	I330N	probably damaging	Het
Rbm46	C	T	3: 82,865,468	R119Q	probably benign	Het
Rubcn	A	C	16: 32,836,543	C502W	possibly damaging	Het
Slc26a10	G	A	10: 127,173,965	R571C	probably benign	Het
Slc44a2	A	T	9: 21,348,138	N587Y	probably damaging	Het
Slfn2	T	G	11: 83,069,759	V188G	possibly damaging	Het
Smok2b	T	C	17: 13,235,793	V280A	probably benign	Het
Snx19	A	G	9: 30,437,465	E798G	probably benign	Het
Sspo	T	C	6: 48,492,609		probably null	Het
Ugt2b37	T	C	5: 87,242,376	I404V	probably benign	Het
Vmn1r160	T	C	7: 22,871,326	F35L	possibly damaging	Het
Vmn1r193	A	T	13: 22,219,116	Y235*	probably null	Het
Vmn2r53	T	C	7: 12,581,916	I659V	probably benign	Het
Vmn2r91	A	G	17: 18,106,500	D349G	probably damaging	Het
Zfp292	A	T	4: 34,806,163	S2299T	probably benign	Het
Zfp938	T	C	10: 82,226,585	N67S	possibly damaging	Het

Other mutations in Nphp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01707:Nphp3	APN	9	104018158	missense	possibly damaging	0.75
IGL02329:Nphp3	APN	9	104025968	missense	probably benign	0.19
lithograph	UTSW	9	104041990	missense	probably damaging	1.00
quartzite	UTSW	9	104036177	missense	probably damaging	1.00
F5770:Nphp3	UTSW	9	104035894	critical splice donor site	probably null
FR4548:Nphp3	UTSW	9	104025939	small deletion	probably benign
FR4589:Nphp3	UTSW	9	104025939	small deletion	probably benign
R0112:Nphp3	UTSW	9	104037348	missense	possibly damaging	0.80
R0555:Nphp3	UTSW	9	104023434	missense	probably damaging	1.00
R0632:Nphp3	UTSW	9	104018274	missense	probably damaging	1.00
R0674:Nphp3	UTSW	9	104036282	critical splice donor site	probably null
R0743:Nphp3	UTSW	9	104022768	small deletion	probably benign
R0853:Nphp3	UTSW	9	104031933	missense	probably benign	0.03
R0920:Nphp3	UTSW	9	104031907	missense	probably benign	0.00
R1420:Nphp3	UTSW	9	104035893	critical splice donor site	probably null
R1464:Nphp3	UTSW	9	104031879	splice site	probably benign
R1476:Nphp3	UTSW	9	104025927	missense	possibly damaging	0.81
R1585:Nphp3	UTSW	9	104009214	missense	probably damaging	1.00
R1608:Nphp3	UTSW	9	104035840	missense	probably benign	0.30
R1688:Nphp3	UTSW	9	104003124	missense	probably damaging	1.00
R1691:Nphp3	UTSW	9	104002811	missense	probably benign
R1807:Nphp3	UTSW	9	104020741	missense	probably benign	0.01
R1857:Nphp3	UTSW	9	104021294	missense	possibly damaging	0.87
R1962:Nphp3	UTSW	9	104021338	missense	probably benign	0.00
R2127:Nphp3	UTSW	9	104008243	missense	probably damaging	0.98
R2138:Nphp3	UTSW	9	104025903	missense	possibly damaging	0.89
R2233:Nphp3	UTSW	9	104037376	missense	probably benign	0.02
R2234:Nphp3	UTSW	9	104037376	missense	probably benign	0.02
R3861:Nphp3	UTSW	9	104039326	unclassified	probably benign
R3928:Nphp3	UTSW	9	104011730	missense	probably damaging	0.99
R3961:Nphp3	UTSW	9	104003042	nonsense	probably null
R4182:Nphp3	UTSW	9	104038464	missense	probably benign	0.06
R4294:Nphp3	UTSW	9	104022717	missense	probably damaging	1.00
R4387:Nphp3	UTSW	9	104030020	missense	possibly damaging	0.94
R4625:Nphp3	UTSW	9	104036159	missense	possibly damaging	0.66
R4628:Nphp3	UTSW	9	104003058	missense	probably damaging	0.99
R4696:Nphp3	UTSW	9	104022732	missense	probably benign	0.01
R4865:Nphp3	UTSW	9	104031970	missense	probably benign
R4886:Nphp3	UTSW	9	104002994	missense	probably damaging	1.00
R4973:Nphp3	UTSW	9	104031999	missense	probably benign
R5445:Nphp3	UTSW	9	104004723	missense	probably damaging	1.00
R5451:Nphp3	UTSW	9	104042022	missense	probably benign
R5520:Nphp3	UTSW	9	104024673	missense	probably benign	0.30
R5641:Nphp3	UTSW	9	104036153	missense	probably damaging	1.00
R5847:Nphp3	UTSW	9	104003037	missense	probably damaging	1.00
R5928:Nphp3	UTSW	9	104035797	missense	probably benign	0.01
R5931:Nphp3	UTSW	9	104020746	missense	probably damaging	1.00
R6161:Nphp3	UTSW	9	104031906	missense	probably benign	0.11
R6298:Nphp3	UTSW	9	104015441	missense	probably damaging	1.00
R6890:Nphp3	UTSW	9	104041954	missense	probably damaging	0.96
R7009:Nphp3	UTSW	9	104016116	missense	probably null	0.00
R7065:Nphp3	UTSW	9	104041990	missense	probably damaging	1.00
R7146:Nphp3	UTSW	9	104004837	nonsense	probably null
R7198:Nphp3	UTSW	9	104004775	missense	probably damaging	1.00
R7360:Nphp3	UTSW	9	104016078	critical splice acceptor site	probably null
R7369:Nphp3	UTSW	9	104018250	missense	probably damaging	0.99
R7554:Nphp3	UTSW	9	104042071	missense	probably damaging	0.98
R7591:Nphp3	UTSW	9	104018278	critical splice donor site	probably null
R7665:Nphp3	UTSW	9	104005393	splice site	probably null
R7672:Nphp3	UTSW	9	104031960	missense	probably benign
R7675:Nphp3	UTSW	9	104016088	missense	probably benign
R8039:Nphp3	UTSW	9	104031963	missense	probably benign
R8145:Nphp3	UTSW	9	104035851	missense	probably benign	0.16
R8882:Nphp3	UTSW	9	104005594	missense	possibly damaging	0.77
R9020:Nphp3	UTSW	9	104031951	missense	probably benign	0.00
R9132:Nphp3	UTSW	9	104020781	missense	probably damaging	1.00
R9135:Nphp3	UTSW	9	104032015	missense	probably damaging	0.99
R9159:Nphp3	UTSW	9	104020781	missense	probably damaging	1.00
R9204:Nphp3	UTSW	9	104042106	missense	probably benign
R9226:Nphp3	UTSW	9	104008129	missense	probably benign	0.00
R9229:Nphp3	UTSW	9	104036177	missense	probably damaging	1.00
R9526:Nphp3	UTSW	9	104036138	missense	probably damaging	1.00
R9678:Nphp3	UTSW	9	104023487	missense	possibly damaging	0.90
R9731:Nphp3	UTSW	9	104009170	missense	probably damaging	1.00
V7583:Nphp3	UTSW	9	104035894	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACTTGCTAGTGTGCACATGTATG -3'
(R):5'- AGTGTTGGACAGGTTTCACATGC -3'

Sequencing Primer
(F):5'- GCACATGTATGAAAGTATGGATGTC -3'
(R):5'- GGACAGGTTTCACATGCAATTTAAAG -3'

Posted On

2020-07-13