Mutagenetix > Incidental Mutation

Incidental Mutation 'R8211:Lrriq1'

636175

Institutional Source

Beutler Lab

Gene Symbol

Lrriq1

Ensembl Gene

ENSMUSG00000019892

Gene Name

leucine-rich repeats and IQ motif containing 1

Synonyms

LOC380658, 4930503E15Rik, Gm1557

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R8211 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103046031-103236322 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103170547 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1239 (L1239P)

Ref Sequence

ENSEMBL: ENSMUSP00000131419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166240]

AlphaFold

Q0P5X1

Predicted Effect

probably damaging
Transcript: ENSMUST00000166240
AA Change: L1239P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: L1239P

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
IQ	290	312	9.78e1	SMART
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
LRR	873	894	2.14e1	SMART
LRR	895	917	4.45e1	SMART
LRR	984	1005	2.03e2	SMART
LRR	1029	1052	3.65e0	SMART
low complexity region	1244	1258	N/A	INTRINSIC
IQ	1279	1301	5.61e1	SMART
IQ	1339	1361	6.7e-3	SMART
low complexity region	1369	1394	N/A	INTRINSIC
low complexity region	1502	1518	N/A	INTRINSIC
low complexity region	1528	1543	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (43/43)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	G	5: 98,329,435	I28V	possibly damaging	Het
A330017A19Rik	A	G	17: 46,890,383		probably benign	Het
Adamtsl3	T	C	7: 82,523,163	S445P	probably damaging	Het
Afp	T	C	5: 90,501,486	I304T	possibly damaging	Het
Alk	G	A	17: 71,869,707	A1534V	probably benign	Het
Ank3	C	T	10: 69,867,398	P287L	unknown	Het
Appl1	T	C	14: 26,945,598	I367V	probably benign	Het
Arpin	T	A	7: 79,935,244	M1L	probably damaging	Het
Aven	C	T	2: 112,559,775	R8W	probably benign	Het
B430203G13Rik	A	T	12: 17,924,539	H82L	noncoding transcript	Het
Bcl11a	T	A	11: 24,078,394	S2T	probably damaging	Het
Cfap46	T	A	7: 139,633,304	M1605L	unknown	Het
Chga	C	A	12: 102,561,419	Q111K	possibly damaging	Het
Drc7	A	G	8: 95,056,079	E24G	unknown	Het
Dst	T	C	1: 34,212,451	L2195P	probably damaging	Het
Enpp5	G	A	17: 44,081,511		probably null	Het
Fat2	A	G	11: 55,312,209	L13P	possibly damaging	Het
Grhl1	T	C	12: 24,586,152		probably null	Het
Ikbke	A	G	1: 131,271,778	I326T	probably damaging	Het
Krt26	C	T	11: 99,335,284	D195N	probably damaging	Het
Lamc2	A	T	1: 153,166,278	C37S	probably damaging	Het
Mrps5	T	A	2: 127,603,724	H390Q	probably benign	Het
Nphp3	T	A	9: 104,031,897	C769S	possibly damaging	Het
Obscn	A	G	11: 59,115,794	S1181P	probably damaging	Het
Olfr921	G	A	9: 38,775,281	V9M	noncoding transcript	Het
Pabpc6	G	T	17: 9,669,457	A55E	probably damaging	Het
Pcdha9	A	T	18: 36,998,859	E327V	possibly damaging	Het
Pds5b	A	G	5: 150,728,942	T225A	possibly damaging	Het
Pi4ka	A	C	16: 17,282,905	I1807S		Het
Pick1	T	A	15: 79,248,730	I330N	probably damaging	Het
Rbm46	C	T	3: 82,865,468	R119Q	probably benign	Het
Rubcn	A	C	16: 32,836,543	C502W	possibly damaging	Het
Slc26a10	G	A	10: 127,173,965	R571C	probably benign	Het
Slc44a2	A	T	9: 21,348,138	N587Y	probably damaging	Het
Slfn2	T	G	11: 83,069,759	V188G	possibly damaging	Het
Smok2b	T	C	17: 13,235,793	V280A	probably benign	Het
Snx19	A	G	9: 30,437,465	E798G	probably benign	Het
Sspo	T	C	6: 48,492,609		probably null	Het
Ugt2b37	T	C	5: 87,242,376	I404V	probably benign	Het
Vmn1r160	T	C	7: 22,871,326	F35L	possibly damaging	Het
Vmn1r193	A	T	13: 22,219,116	Y235*	probably null	Het
Vmn2r53	T	C	7: 12,581,916	I659V	probably benign	Het
Vmn2r91	A	G	17: 18,106,500	D349G	probably damaging	Het
Zfp292	A	T	4: 34,806,163	S2299T	probably benign	Het
Zfp938	T	C	10: 82,226,585	N67S	possibly damaging	Het

Other mutations in Lrriq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Lrriq1	APN	10	103161896	missense	probably damaging	0.99
IGL01523:Lrriq1	APN	10	103218116	nonsense	probably null
IGL01637:Lrriq1	APN	10	103215628	missense	probably benign
IGL02019:Lrriq1	APN	10	103178800	missense	probably benign	0.02
IGL02153:Lrriq1	APN	10	103170479	missense	probably benign	0.01
IGL02341:Lrriq1	APN	10	103224941	missense	probably benign	0.03
IGL02343:Lrriq1	APN	10	103234163	splice site	probably benign
IGL02408:Lrriq1	APN	10	103146281	missense	probably benign	0.17
IGL02431:Lrriq1	APN	10	103200639	missense	probably damaging	1.00
IGL02540:Lrriq1	APN	10	103215019	missense	probably benign	0.02
IGL02558:Lrriq1	APN	10	103146283	missense	probably damaging	1.00
IGL02613:Lrriq1	APN	10	103144548	missense	probably damaging	0.99
IGL02642:Lrriq1	APN	10	103221461	critical splice acceptor site	probably null
IGL03027:Lrriq1	APN	10	103227196	missense	probably benign	0.35
PIT4362001:Lrriq1	UTSW	10	103071194	missense	probably benign	0.26
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0124:Lrriq1	UTSW	10	103170420	critical splice donor site	probably null
R0244:Lrriq1	UTSW	10	103215773	missense	probably damaging	0.98
R0323:Lrriq1	UTSW	10	103221289	missense	possibly damaging	0.91
R0515:Lrriq1	UTSW	10	103068968	splice site	probably null
R0522:Lrriq1	UTSW	10	103161777	missense	probably damaging	0.99
R0701:Lrriq1	UTSW	10	103234044	missense	probably benign
R1220:Lrriq1	UTSW	10	103071129	missense	probably benign	0.05
R1261:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1262:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1451:Lrriq1	UTSW	10	103202515	splice site	probably benign
R1642:Lrriq1	UTSW	10	103214456	missense	probably benign	0.13
R1643:Lrriq1	UTSW	10	103214824	missense	probably benign	0.00
R1647:Lrriq1	UTSW	10	103170648	nonsense	probably null
R1830:Lrriq1	UTSW	10	103161759	missense	probably benign
R1843:Lrriq1	UTSW	10	103227173	splice site	probably null
R2128:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2129:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2199:Lrriq1	UTSW	10	103068913	missense	probably damaging	1.00
R2354:Lrriq1	UTSW	10	103189987	missense	probably damaging	1.00
R2495:Lrriq1	UTSW	10	103202381	missense	probably damaging	0.97
R2897:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2898:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2922:Lrriq1	UTSW	10	103214675	missense	probably benign	0.00
R2939:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R2965:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R2966:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R3081:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R3115:Lrriq1	UTSW	10	103170433	missense	probably benign	0.00
R3745:Lrriq1	UTSW	10	103170856	missense	probably damaging	0.99
R3813:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3814:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3885:Lrriq1	UTSW	10	103216106	missense	probably damaging	0.96
R4378:Lrriq1	UTSW	10	103202364	missense	probably damaging	1.00
R4632:Lrriq1	UTSW	10	103221427	missense	probably damaging	1.00
R4633:Lrriq1	UTSW	10	103200563	nonsense	probably null
R4663:Lrriq1	UTSW	10	103063412	missense	possibly damaging	0.88
R4702:Lrriq1	UTSW	10	103215749	missense	possibly damaging	0.65
R4793:Lrriq1	UTSW	10	103170466	missense	probably benign	0.25
R4801:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4802:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4815:Lrriq1	UTSW	10	103144878	missense	probably benign	0.10
R4872:Lrriq1	UTSW	10	103178788	missense	possibly damaging	0.56
R4877:Lrriq1	UTSW	10	103234038	missense	possibly damaging	0.88
R4894:Lrriq1	UTSW	10	103161752	missense	possibly damaging	0.86
R4990:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R4991:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R5011:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5013:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5122:Lrriq1	UTSW	10	103187453	missense	probably damaging	1.00
R5282:Lrriq1	UTSW	10	103215345	missense	probably benign	0.01
R5311:Lrriq1	UTSW	10	103214587	missense	probably damaging	1.00
R5567:Lrriq1	UTSW	10	103170596	missense	possibly damaging	0.56
R5643:Lrriq1	UTSW	10	103215440	missense	probably benign	0.00
R5683:Lrriq1	UTSW	10	103173375	missense	probably damaging	1.00
R5916:Lrriq1	UTSW	10	103221382	nonsense	probably null
R6008:Lrriq1	UTSW	10	103170464	missense	probably damaging	1.00
R6022:Lrriq1	UTSW	10	103215534	missense	possibly damaging	0.90
R6224:Lrriq1	UTSW	10	103215757	missense	probably damaging	1.00
R6254:Lrriq1	UTSW	10	103215451	missense	probably benign	0.15
R6311:Lrriq1	UTSW	10	103173393	missense	probably benign	0.03
R6460:Lrriq1	UTSW	10	103200698	missense	probably damaging	1.00
R6502:Lrriq1	UTSW	10	103227184	missense	probably damaging	0.99
R6637:Lrriq1	UTSW	10	103221432	missense	probably benign	0.06
R6719:Lrriq1	UTSW	10	103071116	missense	probably damaging	1.00
R6736:Lrriq1	UTSW	10	103181889	critical splice acceptor site	probably null
R6928:Lrriq1	UTSW	10	103214939	missense	possibly damaging	0.95
R6991:Lrriq1	UTSW	10	103187458	missense	probably damaging	1.00
R7174:Lrriq1	UTSW	10	103224965	missense	probably benign
R7241:Lrriq1	UTSW	10	103215973	missense	probably damaging	1.00
R7248:Lrriq1	UTSW	10	103223750	missense	possibly damaging	0.85
R7287:Lrriq1	UTSW	10	103216016	missense	probably benign	0.00
R7402:Lrriq1	UTSW	10	103221324	missense	possibly damaging	0.87
R7439:Lrriq1	UTSW	10	103214519	missense	probably benign	0.21
R7585:Lrriq1	UTSW	10	103214946	missense	possibly damaging	0.93
R7611:Lrriq1	UTSW	10	103200571	missense	possibly damaging	0.54
R7634:Lrriq1	UTSW	10	103200601	missense	probably damaging	1.00
R7767:Lrriq1	UTSW	10	103215954	missense	probably damaging	0.99
R7809:Lrriq1	UTSW	10	103215817	missense	probably damaging	0.99
R7910:Lrriq1	UTSW	10	103215194	nonsense	probably null
R8131:Lrriq1	UTSW	10	103215711	missense	possibly damaging	0.57
R8156:Lrriq1	UTSW	10	103156335	critical splice donor site	probably null
R8304:Lrriq1	UTSW	10	103234068	missense	possibly damaging	0.57
R8487:Lrriq1	UTSW	10	103215053	missense	probably damaging	0.98
R8500:Lrriq1	UTSW	10	103046155	missense
R9013:Lrriq1	UTSW	10	103215070	missense	probably damaging	1.00
R9099:Lrriq1	UTSW	10	103216003	missense	probably damaging	0.98
R9155:Lrriq1	UTSW	10	103214779	missense	probably benign	0.03
R9320:Lrriq1	UTSW	10	103221283	missense	probably benign
R9384:Lrriq1	UTSW	10	103170597	missense	probably benign	0.00
R9469:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R9585:Lrriq1	UTSW	10	103215389	missense	probably benign
R9706:Lrriq1	UTSW	10	103046041	missense
R9780:Lrriq1	UTSW	10	103189963	missense	probably damaging	1.00
X0026:Lrriq1	UTSW	10	103215704	nonsense	probably null
Z1088:Lrriq1	UTSW	10	103202446	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202359	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202360	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103234085	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCACGGCATACATGTACTCAG -3'
(R):5'- CTGAGAGGTCTGCAGCAGAAAC -3'

Sequencing Primer
(F):5'- GGCATACATGTACTCAGCACAC -3'
(R):5'- GTCTGCAGCAGAAACCAACAAAAAC -3'

Posted On

2020-07-13